Multiple sequence alignment - TraesCS7B01G479500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G479500 chr7B 100.000 2996 0 0 1 2996 733886783 733889778 0.000000e+00 5533
1 TraesCS7B01G479500 chr7B 99.575 2120 9 0 877 2996 733863058 733865177 0.000000e+00 3866
2 TraesCS7B01G479500 chr7B 91.876 1514 122 1 877 2390 733927904 733929416 0.000000e+00 2113
3 TraesCS7B01G479500 chr7B 99.548 884 4 0 1 884 733862145 733863028 0.000000e+00 1611
4 TraesCS7B01G479500 chr7B 91.751 885 49 11 1 884 733927013 733927874 0.000000e+00 1208
5 TraesCS7B01G479500 chr7A 91.239 2123 155 13 877 2996 727231426 727233520 0.000000e+00 2861
6 TraesCS7B01G479500 chr7A 92.090 885 47 9 1 884 727230534 727231396 0.000000e+00 1225
7 TraesCS7B01G479500 chr7A 79.401 568 106 8 8 571 726768522 726767962 1.010000e-104 390
8 TraesCS7B01G479500 chr7D 80.696 575 93 10 1 572 631426172 631426731 5.930000e-117 431


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G479500 chr7B 733886783 733889778 2995 False 5533.0 5533 100.0000 1 2996 1 chr7B.!!$F1 2995
1 TraesCS7B01G479500 chr7B 733862145 733865177 3032 False 2738.5 3866 99.5615 1 2996 2 chr7B.!!$F2 2995
2 TraesCS7B01G479500 chr7B 733927013 733929416 2403 False 1660.5 2113 91.8135 1 2390 2 chr7B.!!$F3 2389
3 TraesCS7B01G479500 chr7A 727230534 727233520 2986 False 2043.0 2861 91.6645 1 2996 2 chr7A.!!$F1 2995
4 TraesCS7B01G479500 chr7A 726767962 726768522 560 True 390.0 390 79.4010 8 571 1 chr7A.!!$R1 563
5 TraesCS7B01G479500 chr7D 631426172 631426731 559 False 431.0 431 80.6960 1 572 1 chr7D.!!$F1 571

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
552 553 6.232581 TGTGTCAAAAGGTGATTTGGAAAT 57.767 33.333 0.48 0.0 40.04 2.17 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2808 2846 9.409949 CTAAAAGAAGCTTTATGTCGAATAACG 57.59 33.333 0.0 0.0 44.09 3.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
552 553 6.232581 TGTGTCAAAAGGTGATTTGGAAAT 57.767 33.333 0.48 0.0 40.04 2.17
1042 1080 5.595542 TGCAAAGAATTCCCCAATCTCTATG 59.404 40.000 0.65 0.0 0.00 2.23
2808 2846 0.933796 GCTTCTCATAAGCAGTCGGC 59.066 55.000 4.91 0.0 42.56 5.54
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
185 186 5.388654 AGTCACTTCTGAACCAAATTCCAT 58.611 37.500 0.00 0.0 36.36 3.41
186 187 4.792068 AGTCACTTCTGAACCAAATTCCA 58.208 39.130 0.00 0.0 36.36 3.53
528 529 4.916983 TCCAAATCACCTTTTGACACAG 57.083 40.909 0.00 0.0 38.58 3.66
552 553 0.631753 TCCCCAAACCAACCTCAACA 59.368 50.000 0.00 0.0 0.00 3.33
1028 1066 2.489619 GGCAATGCATAGAGATTGGGGA 60.490 50.000 7.79 0.0 31.38 4.81
1042 1080 1.143183 CCTGCAGGAATGGCAATGC 59.857 57.895 29.88 0.0 41.39 3.56
1262 1300 8.621532 TTTAAATGTGATGCTCTCTACTTTGT 57.378 30.769 0.00 0.0 0.00 2.83
2808 2846 9.409949 CTAAAAGAAGCTTTATGTCGAATAACG 57.590 33.333 0.00 0.0 44.09 3.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.