Multiple sequence alignment - TraesCS7B01G477000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G477000 chr7B 100.000 2459 0 0 1 2459 732897404 732899862 0 4542
1 TraesCS7B01G477000 chr7B 98.049 2460 46 2 1 2459 732796900 732799358 0 4276
2 TraesCS7B01G477000 chr7B 97.886 2460 49 3 1 2459 732847159 732849616 0 4252
3 TraesCS7B01G477000 chr7B 97.661 2437 52 5 1 2435 732822031 732824464 0 4180
4 TraesCS7B01G477000 chr7B 97.538 2437 56 4 1 2435 732872289 732874723 0 4165
5 TraesCS7B01G477000 chr7B 92.636 1521 76 13 950 2459 525928746 525930241 0 2156
6 TraesCS7B01G477000 chr6B 96.174 1516 50 5 950 2459 286754297 286755810 0 2471
7 TraesCS7B01G477000 chr6B 95.428 1531 44 8 950 2459 40667262 40665737 0 2416
8 TraesCS7B01G477000 chr6B 95.578 1515 54 11 950 2459 704787556 704786050 0 2414
9 TraesCS7B01G477000 chr6B 94.947 950 47 1 1 949 576263997 576264946 0 1487
10 TraesCS7B01G477000 chr2B 95.689 1531 43 5 950 2459 43365774 43364246 0 2440
11 TraesCS7B01G477000 chr2B 91.771 1519 72 13 950 2458 28872174 28870699 0 2063
12 TraesCS7B01G477000 chr2B 94.748 952 49 1 1 951 484650648 484649697 0 1480
13 TraesCS7B01G477000 chr2D 93.351 1519 65 9 950 2459 619642003 619640512 0 2213
14 TraesCS7B01G477000 chr4B 95.273 952 44 1 1 951 506235524 506236475 0 1507
15 TraesCS7B01G477000 chr4B 94.953 951 47 1 1 950 506176581 506175631 0 1489
16 TraesCS7B01G477000 chr3B 94.665 956 50 1 1 955 139081565 139082520 0 1482


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G477000 chr7B 732897404 732899862 2458 False 4542 4542 100.000 1 2459 1 chr7B.!!$F6 2458
1 TraesCS7B01G477000 chr7B 732796900 732799358 2458 False 4276 4276 98.049 1 2459 1 chr7B.!!$F2 2458
2 TraesCS7B01G477000 chr7B 732847159 732849616 2457 False 4252 4252 97.886 1 2459 1 chr7B.!!$F4 2458
3 TraesCS7B01G477000 chr7B 732822031 732824464 2433 False 4180 4180 97.661 1 2435 1 chr7B.!!$F3 2434
4 TraesCS7B01G477000 chr7B 732872289 732874723 2434 False 4165 4165 97.538 1 2435 1 chr7B.!!$F5 2434
5 TraesCS7B01G477000 chr7B 525928746 525930241 1495 False 2156 2156 92.636 950 2459 1 chr7B.!!$F1 1509
6 TraesCS7B01G477000 chr6B 286754297 286755810 1513 False 2471 2471 96.174 950 2459 1 chr6B.!!$F1 1509
7 TraesCS7B01G477000 chr6B 40665737 40667262 1525 True 2416 2416 95.428 950 2459 1 chr6B.!!$R1 1509
8 TraesCS7B01G477000 chr6B 704786050 704787556 1506 True 2414 2414 95.578 950 2459 1 chr6B.!!$R2 1509
9 TraesCS7B01G477000 chr6B 576263997 576264946 949 False 1487 1487 94.947 1 949 1 chr6B.!!$F2 948
10 TraesCS7B01G477000 chr2B 43364246 43365774 1528 True 2440 2440 95.689 950 2459 1 chr2B.!!$R2 1509
11 TraesCS7B01G477000 chr2B 28870699 28872174 1475 True 2063 2063 91.771 950 2458 1 chr2B.!!$R1 1508
12 TraesCS7B01G477000 chr2B 484649697 484650648 951 True 1480 1480 94.748 1 951 1 chr2B.!!$R3 950
13 TraesCS7B01G477000 chr2D 619640512 619642003 1491 True 2213 2213 93.351 950 2459 1 chr2D.!!$R1 1509
14 TraesCS7B01G477000 chr4B 506235524 506236475 951 False 1507 1507 95.273 1 951 1 chr4B.!!$F1 950
15 TraesCS7B01G477000 chr4B 506175631 506176581 950 True 1489 1489 94.953 1 950 1 chr4B.!!$R1 949
16 TraesCS7B01G477000 chr3B 139081565 139082520 955 False 1482 1482 94.665 1 955 1 chr3B.!!$F1 954

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
189 190 1.827394 GCCCAATCTGGCCGTACTA 59.173 57.895 0.00 0.0 46.11 1.82 F
476 477 3.190118 GGAACTCTCAATGAAAGCACCAG 59.810 47.826 0.00 0.0 0.00 4.00 F
697 698 3.621682 ACCCTAGAAGCTAGCCTATGT 57.378 47.619 12.13 4.6 0.00 2.29 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1024 1026 0.251634 TACTGCGTCCATGATTGGCA 59.748 50.000 0.00 0.00 43.29 4.92 R
1374 1384 0.895559 GCTCTTGGGTTGGGGTTGAG 60.896 60.000 0.00 0.00 0.00 3.02 R
2152 2193 1.152881 GCAACTAGGAGCCCCATGG 60.153 63.158 4.14 4.14 33.88 3.66 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
119 120 2.484065 CCACGTTGTTCTTCCACCACTA 60.484 50.000 0.00 0.0 0.00 2.74
189 190 1.827394 GCCCAATCTGGCCGTACTA 59.173 57.895 0.00 0.0 46.11 1.82
476 477 3.190118 GGAACTCTCAATGAAAGCACCAG 59.810 47.826 0.00 0.0 0.00 4.00
525 526 4.061699 GGGGGTCCCGAACTATGT 57.938 61.111 0.48 0.0 36.85 2.29
697 698 3.621682 ACCCTAGAAGCTAGCCTATGT 57.378 47.619 12.13 4.6 0.00 2.29
751 752 5.597182 ACTCTCCGGTTTATATAGACAGCAA 59.403 40.000 0.00 0.0 0.00 3.91
1024 1026 4.070552 GCTCGACTTCGGCCACCT 62.071 66.667 2.24 0.0 40.29 4.00
1366 1376 6.797033 CGATGACTATGTTGAAAGGTTGAAAC 59.203 38.462 0.00 0.0 0.00 2.78
1374 1384 1.613925 GAAAGGTTGAAACTGGAGGGC 59.386 52.381 0.00 0.0 0.00 5.19
2148 2189 3.134623 CCTAGTTGCATGTCCATAGTGGA 59.865 47.826 0.00 0.0 45.98 4.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
100 101 2.800629 CGTAGTGGTGGAAGAACAACGT 60.801 50.000 0.00 0.00 0.00 3.99
119 120 2.107546 GTTCACCCACCACGTCGT 59.892 61.111 0.00 0.00 0.00 4.34
187 188 0.962489 CCCTGGGAGTCGCTACATAG 59.038 60.000 7.01 0.00 0.00 2.23
189 190 2.435693 GCCCTGGGAGTCGCTACAT 61.436 63.158 19.27 0.00 0.00 2.29
215 216 2.168521 CCCTAAACGAGCTCTTGGATCA 59.831 50.000 12.85 0.00 0.00 2.92
525 526 1.754803 CTGTTACCATCCGCCTAGACA 59.245 52.381 0.00 0.00 0.00 3.41
751 752 2.188817 CTGTGTAACCCTAGCCCTCTT 58.811 52.381 0.00 0.00 34.36 2.85
924 925 1.057471 GGTCCTAGATTAGGGGGTGC 58.943 60.000 2.49 0.00 46.24 5.01
937 938 1.757508 AAGGTGGGTGAGGGGTCCTA 61.758 60.000 0.00 0.00 31.76 2.94
1024 1026 0.251634 TACTGCGTCCATGATTGGCA 59.748 50.000 0.00 0.00 43.29 4.92
1374 1384 0.895559 GCTCTTGGGTTGGGGTTGAG 60.896 60.000 0.00 0.00 0.00 3.02
2148 2189 1.912862 ACTAGGAGCCCCATGGAAAT 58.087 50.000 15.22 0.00 33.88 2.17
2152 2193 1.152881 GCAACTAGGAGCCCCATGG 60.153 63.158 4.14 4.14 33.88 3.66
2294 2359 9.219603 GTGCTATTATTTGTAGATTGCTATGGA 57.780 33.333 0.00 0.00 0.00 3.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.