Multiple sequence alignment - TraesCS7B01G476900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G476900 chr7B 100.000 2459 0 0 1 2459 732872290 732874748 0 4542
1 TraesCS7B01G476900 chr7B 98.659 2460 30 3 1 2459 732822032 732824489 0 4357
2 TraesCS7B01G476900 chr7B 97.783 2436 49 5 1 2434 732847160 732849592 0 4194
3 TraesCS7B01G476900 chr7B 97.701 2436 52 4 1 2434 732796901 732799334 0 4185
4 TraesCS7B01G476900 chr7B 97.537 2436 56 4 1 2434 732897405 732899838 0 4163
5 TraesCS7B01G476900 chr7B 92.638 1467 72 13 950 2404 525928746 525930188 0 2078
6 TraesCS7B01G476900 chr6B 95.678 1504 51 10 950 2445 286754297 286755794 0 2405
7 TraesCS7B01G476900 chr6B 95.241 1492 55 14 950 2434 704787556 704786074 0 2348
8 TraesCS7B01G476900 chr6B 94.942 949 48 0 1 949 576263998 576264946 0 1487
9 TraesCS7B01G476900 chr2B 94.600 1537 52 14 950 2459 13218346 13216814 0 2350
10 TraesCS7B01G476900 chr2B 91.782 1521 86 17 950 2457 28872174 28870680 0 2080
11 TraesCS7B01G476900 chr2B 91.255 709 33 12 1758 2459 4009283 4008597 0 939
12 TraesCS7B01G476900 chr2B 95.803 548 21 2 1913 2459 774269674 774269128 0 883
13 TraesCS7B01G476900 chr2D 93.242 1465 63 10 950 2404 619642003 619640565 0 2124
14 TraesCS7B01G476900 chr4B 95.058 951 47 0 1 951 506235525 506236475 0 1496
15 TraesCS7B01G476900 chr4B 95.053 950 47 0 1 950 506176580 506175631 0 1495
16 TraesCS7B01G476900 chr3B 94.869 955 49 0 1 955 139081566 139082520 0 1493
17 TraesCS7B01G476900 chr3B 94.731 949 50 0 1 949 137205600 137204652 0 1476


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G476900 chr7B 732872290 732874748 2458 False 4542 4542 100.000 1 2459 1 chr7B.!!$F5 2458
1 TraesCS7B01G476900 chr7B 732822032 732824489 2457 False 4357 4357 98.659 1 2459 1 chr7B.!!$F3 2458
2 TraesCS7B01G476900 chr7B 732847160 732849592 2432 False 4194 4194 97.783 1 2434 1 chr7B.!!$F4 2433
3 TraesCS7B01G476900 chr7B 732796901 732799334 2433 False 4185 4185 97.701 1 2434 1 chr7B.!!$F2 2433
4 TraesCS7B01G476900 chr7B 732897405 732899838 2433 False 4163 4163 97.537 1 2434 1 chr7B.!!$F6 2433
5 TraesCS7B01G476900 chr7B 525928746 525930188 1442 False 2078 2078 92.638 950 2404 1 chr7B.!!$F1 1454
6 TraesCS7B01G476900 chr6B 286754297 286755794 1497 False 2405 2405 95.678 950 2445 1 chr6B.!!$F1 1495
7 TraesCS7B01G476900 chr6B 704786074 704787556 1482 True 2348 2348 95.241 950 2434 1 chr6B.!!$R1 1484
8 TraesCS7B01G476900 chr6B 576263998 576264946 948 False 1487 1487 94.942 1 949 1 chr6B.!!$F2 948
9 TraesCS7B01G476900 chr2B 13216814 13218346 1532 True 2350 2350 94.600 950 2459 1 chr2B.!!$R2 1509
10 TraesCS7B01G476900 chr2B 28870680 28872174 1494 True 2080 2080 91.782 950 2457 1 chr2B.!!$R3 1507
11 TraesCS7B01G476900 chr2B 4008597 4009283 686 True 939 939 91.255 1758 2459 1 chr2B.!!$R1 701
12 TraesCS7B01G476900 chr2B 774269128 774269674 546 True 883 883 95.803 1913 2459 1 chr2B.!!$R4 546
13 TraesCS7B01G476900 chr2D 619640565 619642003 1438 True 2124 2124 93.242 950 2404 1 chr2D.!!$R1 1454
14 TraesCS7B01G476900 chr4B 506235525 506236475 950 False 1496 1496 95.058 1 951 1 chr4B.!!$F1 950
15 TraesCS7B01G476900 chr4B 506175631 506176580 949 True 1495 1495 95.053 1 950 1 chr4B.!!$R1 949
16 TraesCS7B01G476900 chr3B 139081566 139082520 954 False 1493 1493 94.869 1 955 1 chr3B.!!$F1 954
17 TraesCS7B01G476900 chr3B 137204652 137205600 948 True 1476 1476 94.731 1 949 1 chr3B.!!$R1 948

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
792 793 0.533491 TCGGTTACAACGGGAGGATG 59.467 55.0 0.0 0.0 0.0 3.51 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1906 1928 1.134068 GGGTGGGCTGGTCTCTATTTC 60.134 57.143 0.0 0.0 0.0 2.17 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
509 510 2.203451 GGCGGATCTCGGGTAGGA 60.203 66.667 5.87 0.00 39.69 2.94
619 620 5.712152 AAAACCCTACTTCTGCTTGATTG 57.288 39.130 0.00 0.00 0.00 2.67
690 691 3.310193 AGGCTAAACCCTAGAAGCTAGG 58.690 50.000 12.53 12.53 40.58 3.02
791 792 0.533951 GTCGGTTACAACGGGAGGAT 59.466 55.000 0.00 0.00 0.00 3.24
792 793 0.533491 TCGGTTACAACGGGAGGATG 59.467 55.000 0.00 0.00 0.00 3.51
1234 1237 8.940397 TGTCTAATTTCTCCCAATTTCTTTCT 57.060 30.769 0.00 0.00 0.00 2.52
1602 1613 6.548441 TGGGTTTAGTTTACTTGATGTTCG 57.452 37.500 0.00 0.00 0.00 3.95
1863 1885 1.343069 ACTGGGCCTCCGAATAGATC 58.657 55.000 4.53 0.00 35.24 2.75
1906 1928 2.358898 CCTGAGAAAATAACCATGCCCG 59.641 50.000 0.00 0.00 0.00 6.13
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
509 510 0.683504 AGACGCATAGTTCGGGACCT 60.684 55.000 0.00 0.0 0.00 3.85
655 656 3.283259 TTAGCCTCTCTGATCTCGTGA 57.717 47.619 0.00 0.0 0.00 4.35
690 691 5.277345 GGACGAACAACAATCATACCATAGC 60.277 44.000 0.00 0.0 0.00 2.97
745 746 0.637195 AACCCTAGCCCTCTCTGCTA 59.363 55.000 0.00 0.0 40.23 3.49
791 792 4.546570 CTTGGCGATACGATATGAAGACA 58.453 43.478 0.00 0.0 0.00 3.41
792 793 3.365220 GCTTGGCGATACGATATGAAGAC 59.635 47.826 0.00 0.0 0.00 3.01
1602 1613 7.527084 ACTCTAACAAATTCTAGCGATTGAC 57.473 36.000 7.82 0.0 0.00 3.18
1852 1874 1.801242 TGGCCCAAGATCTATTCGGA 58.199 50.000 0.00 0.0 0.00 4.55
1863 1885 1.483415 CCCATTTTCTCATGGCCCAAG 59.517 52.381 0.00 0.0 42.39 3.61
1906 1928 1.134068 GGGTGGGCTGGTCTCTATTTC 60.134 57.143 0.00 0.0 0.00 2.17


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.