Multiple sequence alignment - TraesCS7B01G476100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G476100 chr7B 100.000 4090 0 0 1 4090 732385175 732381086 0.000000e+00 7553
1 TraesCS7B01G476100 chr7B 99.245 3710 17 4 1 3701 732415308 732411601 0.000000e+00 6685
2 TraesCS7B01G476100 chr7B 78.899 1308 227 38 1858 3146 732194336 732195613 0.000000e+00 841
3 TraesCS7B01G476100 chr7B 98.442 385 5 1 3706 4090 732411402 732411019 0.000000e+00 676
4 TraesCS7B01G476100 chr7B 82.927 205 35 0 995 1199 732178762 732178966 6.980000e-43 185
5 TraesCS7B01G476100 chrUn 99.433 3703 19 1 1 3701 281884330 281880628 0.000000e+00 6721
6 TraesCS7B01G476100 chrUn 99.406 3705 16 4 1 3701 187447801 187444099 0.000000e+00 6715
7 TraesCS7B01G476100 chrUn 99.325 3706 20 2 1 3701 224360717 224364422 0.000000e+00 6700
8 TraesCS7B01G476100 chrUn 99.400 3666 16 3 41 3701 234832885 234836549 0.000000e+00 6643
9 TraesCS7B01G476100 chrUn 99.330 2985 12 3 474 3452 88202827 88205809 0.000000e+00 5395
10 TraesCS7B01G476100 chrUn 99.089 2195 15 2 1 2190 187418586 187416392 0.000000e+00 3938
11 TraesCS7B01G476100 chrUn 98.765 972 10 1 1 970 350614750 350613779 0.000000e+00 1727
12 TraesCS7B01G476100 chrUn 98.663 972 11 1 1 970 213295269 213296240 0.000000e+00 1722
13 TraesCS7B01G476100 chrUn 100.000 605 0 0 3097 3701 392744237 392743633 0.000000e+00 1118
14 TraesCS7B01G476100 chrUn 99.835 605 1 0 3097 3701 389333606 389333002 0.000000e+00 1112
15 TraesCS7B01G476100 chrUn 100.000 500 0 0 1210 1709 448178236 448177737 0.000000e+00 924
16 TraesCS7B01G476100 chrUn 99.221 385 2 1 3706 4090 187443900 187443517 0.000000e+00 693
17 TraesCS7B01G476100 chrUn 98.961 385 4 0 3706 4090 367546005 367545621 0.000000e+00 689
18 TraesCS7B01G476100 chrUn 98.958 384 2 2 3707 4090 281880429 281880048 0.000000e+00 686
19 TraesCS7B01G476100 chrUn 98.958 384 2 2 3707 4090 389332801 389332420 0.000000e+00 686
20 TraesCS7B01G476100 chrUn 98.701 385 3 2 3706 4090 367747814 367747432 0.000000e+00 682
21 TraesCS7B01G476100 chrUn 98.442 385 4 2 3706 4090 413758983 413759365 0.000000e+00 676
22 TraesCS7B01G476100 chrUn 98.438 384 4 2 3707 4090 224364621 224365002 0.000000e+00 675
23 TraesCS7B01G476100 chrUn 98.187 386 5 2 3706 4090 234836748 234837132 0.000000e+00 673
24 TraesCS7B01G476100 chrUn 100.000 222 0 0 3480 3701 367546425 367546204 1.060000e-110 411
25 TraesCS7B01G476100 chrUn 100.000 222 0 0 3480 3701 413758563 413758784 1.060000e-110 411
26 TraesCS7B01G476100 chr7D 84.123 1751 243 29 1532 3261 629422756 629421020 0.000000e+00 1661
27 TraesCS7B01G476100 chr7D 80.797 1229 201 26 2003 3217 629330034 629328827 0.000000e+00 929
28 TraesCS7B01G476100 chr7D 89.391 509 54 0 943 1451 629423646 629423138 3.450000e-180 641
29 TraesCS7B01G476100 chr7A 80.016 1226 218 20 2003 3217 725231381 725230172 0.000000e+00 881


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G476100 chr7B 732381086 732385175 4089 True 7553.0 7553 100.0000 1 4090 1 chr7B.!!$R1 4089
1 TraesCS7B01G476100 chr7B 732411019 732415308 4289 True 3680.5 6685 98.8435 1 4090 2 chr7B.!!$R2 4089
2 TraesCS7B01G476100 chr7B 732194336 732195613 1277 False 841.0 841 78.8990 1858 3146 1 chr7B.!!$F2 1288
3 TraesCS7B01G476100 chrUn 88202827 88205809 2982 False 5395.0 5395 99.3300 474 3452 1 chrUn.!!$F1 2978
4 TraesCS7B01G476100 chrUn 187416392 187418586 2194 True 3938.0 3938 99.0890 1 2190 1 chrUn.!!$R1 2189
5 TraesCS7B01G476100 chrUn 187443517 187447801 4284 True 3704.0 6715 99.3135 1 4090 2 chrUn.!!$R6 4089
6 TraesCS7B01G476100 chrUn 281880048 281884330 4282 True 3703.5 6721 99.1955 1 4090 2 chrUn.!!$R7 4089
7 TraesCS7B01G476100 chrUn 224360717 224365002 4285 False 3687.5 6700 98.8815 1 4090 2 chrUn.!!$F3 4089
8 TraesCS7B01G476100 chrUn 234832885 234837132 4247 False 3658.0 6643 98.7935 41 4090 2 chrUn.!!$F4 4049
9 TraesCS7B01G476100 chrUn 350613779 350614750 971 True 1727.0 1727 98.7650 1 970 1 chrUn.!!$R2 969
10 TraesCS7B01G476100 chrUn 213295269 213296240 971 False 1722.0 1722 98.6630 1 970 1 chrUn.!!$F2 969
11 TraesCS7B01G476100 chrUn 392743633 392744237 604 True 1118.0 1118 100.0000 3097 3701 1 chrUn.!!$R4 604
12 TraesCS7B01G476100 chrUn 389332420 389333606 1186 True 899.0 1112 99.3965 3097 4090 2 chrUn.!!$R9 993
13 TraesCS7B01G476100 chrUn 367545621 367546425 804 True 550.0 689 99.4805 3480 4090 2 chrUn.!!$R8 610
14 TraesCS7B01G476100 chrUn 413758563 413759365 802 False 543.5 676 99.2210 3480 4090 2 chrUn.!!$F5 610
15 TraesCS7B01G476100 chr7D 629421020 629423646 2626 True 1151.0 1661 86.7570 943 3261 2 chr7D.!!$R2 2318
16 TraesCS7B01G476100 chr7D 629328827 629330034 1207 True 929.0 929 80.7970 2003 3217 1 chr7D.!!$R1 1214
17 TraesCS7B01G476100 chr7A 725230172 725231381 1209 True 881.0 881 80.0160 2003 3217 1 chr7A.!!$R1 1214

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
213 214 1.610522 GACTGTTTGCTGCATTGTCCT 59.389 47.619 1.84 0.0 0.00 3.85 F
2186 2517 5.455326 GCTACCATCTTGACTCCATTGGTAT 60.455 44.000 1.86 0.0 38.61 2.73 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2925 3268 4.488790 ATGGAATCCGCCATGAGC 57.511 55.556 0.00 0.0 46.62 4.26 R
3721 4268 5.889289 AGAAGTCTAGGGATGACAAGTCTAC 59.111 44.000 1.53 0.0 36.94 2.59 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
213 214 1.610522 GACTGTTTGCTGCATTGTCCT 59.389 47.619 1.84 0.0 0.00 3.85
2186 2517 5.455326 GCTACCATCTTGACTCCATTGGTAT 60.455 44.000 1.86 0.0 38.61 2.73
3704 4054 8.747538 AAACCTCATAATAATTAGAAACGCCT 57.252 30.769 0.00 0.0 0.00 5.52
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
213 214 1.155889 CACGGCAATGTAGCAGACAA 58.844 50.000 0.00 0.0 42.78 3.18
359 360 3.831911 TCCAAAATTTAGCAGGAGGTTGG 59.168 43.478 0.00 0.0 36.44 3.77
835 836 0.663688 CTGCTACTGTATCCGTCGCT 59.336 55.000 0.00 0.0 0.00 4.93
2925 3268 4.488790 ATGGAATCCGCCATGAGC 57.511 55.556 0.00 0.0 46.62 4.26
3721 4268 5.889289 AGAAGTCTAGGGATGACAAGTCTAC 59.111 44.000 1.53 0.0 36.94 2.59


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.