Multiple sequence alignment - TraesCS7B01G476000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G476000 chr7B 100.000 2984 0 0 1 2984 732201982 732198999 0.000000e+00 5511.0
1 TraesCS7B01G476000 chr7B 99.231 2989 18 3 1 2984 732160112 732157124 0.000000e+00 5387.0
2 TraesCS7B01G476000 chr7B 90.000 50 5 0 2886 2935 726158701 726158750 6.900000e-07 65.8
3 TraesCS7B01G476000 chr2B 89.360 1109 106 4 887 1986 64356686 64357791 0.000000e+00 1384.0
4 TraesCS7B01G476000 chr2B 73.843 864 160 39 1112 1960 1749882 1750694 1.750000e-72 283.0
5 TraesCS7B01G476000 chr2B 73.918 855 150 45 1125 1960 1765057 1765857 2.930000e-70 276.0
6 TraesCS7B01G476000 chr2D 86.847 1072 106 13 886 1950 37225439 37224396 0.000000e+00 1166.0
7 TraesCS7B01G476000 chr2D 80.693 1010 161 21 976 1960 3119141 3120141 0.000000e+00 754.0
8 TraesCS7B01G476000 chr2D 79.632 653 113 9 937 1582 4597623 4596984 4.540000e-123 451.0
9 TraesCS7B01G476000 chr2D 85.366 287 33 5 61 340 563004282 563003998 3.760000e-74 289.0
10 TraesCS7B01G476000 chr2D 80.315 127 22 3 1534 1659 7206716 7206592 3.170000e-15 93.5
11 TraesCS7B01G476000 chr6B 85.538 325 39 4 350 666 144891369 144891693 1.710000e-87 333.0
12 TraesCS7B01G476000 chr5B 85.266 319 38 6 352 664 101321152 101321467 1.330000e-83 320.0
13 TraesCS7B01G476000 chr5B 72.296 675 130 41 1130 1792 537506318 537506947 1.110000e-34 158.0
14 TraesCS7B01G476000 chr1D 84.877 324 39 5 352 667 492108219 492107898 4.800000e-83 318.0
15 TraesCS7B01G476000 chr7D 89.916 238 22 1 98 335 595688123 595687888 3.740000e-79 305.0
16 TraesCS7B01G476000 chr7D 83.540 322 43 7 350 663 333633992 333633673 2.910000e-75 292.0
17 TraesCS7B01G476000 chr7D 83.502 297 38 9 42 336 507792435 507792722 1.760000e-67 267.0
18 TraesCS7B01G476000 chr7D 78.963 328 52 10 2441 2757 628545979 628546300 1.080000e-49 207.0
19 TraesCS7B01G476000 chr7D 88.136 59 7 0 2833 2891 510849642 510849700 1.480000e-08 71.3
20 TraesCS7B01G476000 chr7D 95.556 45 1 1 2934 2978 629875432 629875475 1.480000e-08 71.3
21 TraesCS7B01G476000 chr7A 89.958 239 21 2 98 335 721584584 721584348 3.740000e-79 305.0
22 TraesCS7B01G476000 chr7A 80.844 308 53 5 2451 2757 604518876 604518574 1.380000e-58 237.0
23 TraesCS7B01G476000 chr5D 83.750 320 45 3 352 664 286475054 286475373 2.250000e-76 296.0
24 TraesCS7B01G476000 chr5D 83.025 324 32 10 348 664 484282474 484282781 3.790000e-69 272.0
25 TraesCS7B01G476000 chr5D 81.562 320 50 4 352 664 94024111 94024428 3.820000e-64 255.0
26 TraesCS7B01G476000 chr5D 73.352 728 125 41 1098 1792 441158390 441159081 3.900000e-49 206.0
27 TraesCS7B01G476000 chr5D 72.069 870 175 50 1097 1944 441327294 441328117 6.520000e-47 198.0
28 TraesCS7B01G476000 chr6D 88.750 240 25 1 98 337 18495363 18495600 2.910000e-75 292.0
29 TraesCS7B01G476000 chr6D 88.983 236 23 2 98 333 285809858 285810090 3.760000e-74 289.0
30 TraesCS7B01G476000 chr6D 75.000 232 53 5 2477 2706 419589392 419589620 5.260000e-18 102.0
31 TraesCS7B01G476000 chr5A 89.224 232 23 1 98 329 647359620 647359849 3.760000e-74 289.0
32 TraesCS7B01G476000 chr5A 75.806 310 60 13 1599 1901 706559893 706559592 3.100000e-30 143.0
33 TraesCS7B01G476000 chr5A 76.147 218 38 8 2550 2756 268332632 268332418 5.260000e-18 102.0
34 TraesCS7B01G476000 chr6A 88.333 240 25 2 98 336 57972585 57972822 4.870000e-73 285.0
35 TraesCS7B01G476000 chr3A 82.462 325 46 6 348 664 714368759 714369080 1.050000e-69 274.0
36 TraesCS7B01G476000 chr3A 78.191 188 38 2 2441 2626 673712803 673712989 1.880000e-22 117.0
37 TraesCS7B01G476000 chr3A 93.182 44 3 0 2451 2494 589185445 589185488 6.900000e-07 65.8
38 TraesCS7B01G476000 chr3B 74.118 340 75 6 2442 2770 31431826 31431489 8.680000e-26 128.0
39 TraesCS7B01G476000 chr1A 88.312 77 7 1 2441 2515 547947424 547947348 1.140000e-14 91.6
40 TraesCS7B01G476000 chr3D 81.553 103 18 1 2831 2933 64329852 64329751 1.910000e-12 84.2
41 TraesCS7B01G476000 chr2A 79.808 104 19 2 2831 2934 468596121 468596020 1.150000e-09 75.0
42 TraesCS7B01G476000 chr4B 87.097 62 6 1 2369 2428 41614280 41614341 5.340000e-08 69.4
43 TraesCS7B01G476000 chr1B 85.294 68 8 1 2363 2428 605585807 605585874 5.340000e-08 69.4


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G476000 chr7B 732198999 732201982 2983 True 5511 5511 100.000 1 2984 1 chr7B.!!$R2 2983
1 TraesCS7B01G476000 chr7B 732157124 732160112 2988 True 5387 5387 99.231 1 2984 1 chr7B.!!$R1 2983
2 TraesCS7B01G476000 chr2B 64356686 64357791 1105 False 1384 1384 89.360 887 1986 1 chr2B.!!$F3 1099
3 TraesCS7B01G476000 chr2B 1749882 1750694 812 False 283 283 73.843 1112 1960 1 chr2B.!!$F1 848
4 TraesCS7B01G476000 chr2B 1765057 1765857 800 False 276 276 73.918 1125 1960 1 chr2B.!!$F2 835
5 TraesCS7B01G476000 chr2D 37224396 37225439 1043 True 1166 1166 86.847 886 1950 1 chr2D.!!$R3 1064
6 TraesCS7B01G476000 chr2D 3119141 3120141 1000 False 754 754 80.693 976 1960 1 chr2D.!!$F1 984
7 TraesCS7B01G476000 chr2D 4596984 4597623 639 True 451 451 79.632 937 1582 1 chr2D.!!$R1 645
8 TraesCS7B01G476000 chr5D 441158390 441159081 691 False 206 206 73.352 1098 1792 1 chr5D.!!$F3 694

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
339 341 0.785708 CACAAGTTGATTCGCGCGTC 60.786 55.0 30.98 21.37 0.0 5.19 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2070 2151 1.878102 GCAGGAAGAAAGCGAAGGTGA 60.878 52.381 0.0 0.0 39.47 4.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
91 93 6.435562 GTAAGCACTCATACTTACGCATAC 57.564 41.667 0.00 0.00 39.00 2.39
190 192 2.985282 ACCGTAACCGCCTCGTCA 60.985 61.111 0.00 0.00 0.00 4.35
249 251 5.171337 CGCCGAAAATCCTCAAATAAATTCG 59.829 40.000 0.00 0.00 38.41 3.34
339 341 0.785708 CACAAGTTGATTCGCGCGTC 60.786 55.000 30.98 21.37 0.00 5.19
593 595 1.846007 AAGCAATATTGTTCCCGGCA 58.154 45.000 16.61 0.00 0.00 5.69
1616 1681 1.749638 CGCTCGAGTACTGGGAGGT 60.750 63.158 15.13 0.00 0.00 3.85
2070 2151 2.242965 TGGCCATCACATTCTTCCTCAT 59.757 45.455 0.00 0.00 0.00 2.90
2155 2236 3.233507 AGAGTTGGGCATCAAACACATT 58.766 40.909 0.00 0.00 37.08 2.71
2278 2359 0.458889 CAAATCGGGCCACATTGCAG 60.459 55.000 4.39 0.00 0.00 4.41
2402 2487 6.653526 TTCTTCTTTGAAGCAATGGATTCA 57.346 33.333 0.00 0.00 46.84 2.57
2848 2933 1.303317 GTGTTGGATGGCCGGTTCT 60.303 57.895 1.90 0.00 36.79 3.01
2861 2946 1.215647 GGTTCTCGCATCCGTGTCT 59.784 57.895 0.00 0.00 35.54 3.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
9 10 4.358494 ACGCACTGTTAGACATAGAGAC 57.642 45.455 0.0 0.0 0.00 3.36
91 93 1.351707 GGTGTGCGTGTGTTGAGTG 59.648 57.895 0.0 0.0 0.00 3.51
249 251 2.706636 TGCTGCTCGCATTATTCCC 58.293 52.632 0.0 0.0 45.47 3.97
339 341 3.490078 GGAGATGCTCTAAGTCAACTCCG 60.490 52.174 0.0 0.0 40.68 4.63
482 484 3.798878 CCTAATATATCCTGCGTGCGATG 59.201 47.826 0.0 0.0 0.00 3.84
2070 2151 1.878102 GCAGGAAGAAAGCGAAGGTGA 60.878 52.381 0.0 0.0 39.47 4.02
2278 2359 2.484889 GAAGGAGTACCGCATTGGATC 58.515 52.381 0.0 0.0 42.00 3.36


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.