Multiple sequence alignment - TraesCS7B01G475600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G475600 chr7B 100.000 5147 0 0 1 5147 731958090 731963236 0.000000e+00 9505.0
1 TraesCS7B01G475600 chr7B 99.152 3418 27 2 1731 5147 732085577 732088993 0.000000e+00 6150.0
2 TraesCS7B01G475600 chr7B 99.326 1631 10 1 1397 3026 732023128 732024758 0.000000e+00 2950.0
3 TraesCS7B01G475600 chr7B 99.606 508 2 0 1 508 732083265 732083772 0.000000e+00 928.0
4 TraesCS7B01G475600 chr7B 81.600 125 16 7 1320 1441 39982161 39982041 4.240000e-16 97.1
5 TraesCS7B01G475600 chrUn 99.236 4451 33 1 698 5147 160380852 160385302 0.000000e+00 8030.0
6 TraesCS7B01G475600 chrUn 99.175 3274 26 1 1875 5147 88428164 88431437 0.000000e+00 5895.0
7 TraesCS7B01G475600 chrUn 99.331 2241 14 1 1875 4114 347938452 347940692 0.000000e+00 4054.0
8 TraesCS7B01G475600 chrUn 99.137 1854 15 1 698 2551 245413839 245415691 0.000000e+00 3334.0
9 TraesCS7B01G475600 chrUn 98.727 1650 20 1 3499 5147 160319656 160321305 0.000000e+00 2929.0
10 TraesCS7B01G475600 chrUn 99.734 1129 3 0 2716 3844 435950828 435951956 0.000000e+00 2069.0
11 TraesCS7B01G475600 chrUn 99.308 1011 7 0 698 1708 260934038 260935048 0.000000e+00 1829.0
12 TraesCS7B01G475600 chrUn 99.405 1008 6 0 701 1708 361666864 361665857 0.000000e+00 1829.0
13 TraesCS7B01G475600 chrUn 99.671 911 2 1 2587 3497 245415689 245416598 0.000000e+00 1664.0
14 TraesCS7B01G475600 chrUn 99.117 906 8 0 892 1797 460792018 460791113 0.000000e+00 1629.0
15 TraesCS7B01G475600 chrUn 99.289 703 3 1 1 703 260933297 260933997 0.000000e+00 1269.0
16 TraesCS7B01G475600 chrUn 99.289 703 2 1 1 703 160380112 160380811 0.000000e+00 1267.0
17 TraesCS7B01G475600 chrUn 98.720 703 7 1 1 703 300936822 300936122 0.000000e+00 1247.0
18 TraesCS7B01G475600 chrUn 98.578 703 7 1 1 703 160316110 160316809 0.000000e+00 1240.0
19 TraesCS7B01G475600 chrUn 98.578 703 6 1 1 703 300955395 300954697 0.000000e+00 1240.0
20 TraesCS7B01G475600 chrUn 98.578 703 7 1 1 703 361667607 361666908 0.000000e+00 1240.0
21 TraesCS7B01G475600 chrUn 99.530 638 3 0 701 1338 300936078 300935441 0.000000e+00 1162.0
22 TraesCS7B01G475600 chrUn 99.530 638 3 0 701 1338 300954653 300954016 0.000000e+00 1162.0
23 TraesCS7B01G475600 chrUn 98.844 519 6 0 4629 5147 292554718 292555236 0.000000e+00 926.0
24 TraesCS7B01G475600 chrUn 83.230 483 74 6 3391 3870 2665043 2664565 2.200000e-118 436.0
25 TraesCS7B01G475600 chrUn 99.127 229 2 0 698 926 160316850 160317078 3.710000e-111 412.0
26 TraesCS7B01G475600 chrUn 100.000 159 0 0 545 703 245413640 245413798 1.400000e-75 294.0
27 TraesCS7B01G475600 chr7D 92.747 1944 126 8 2875 4808 628832882 628830944 0.000000e+00 2795.0
28 TraesCS7B01G475600 chr7D 92.733 633 33 9 2254 2880 628833554 628832929 0.000000e+00 902.0
29 TraesCS7B01G475600 chr7D 73.469 343 78 13 88 423 447906272 447906608 3.260000e-22 117.0
30 TraesCS7B01G475600 chr7D 100.000 30 0 0 2231 2260 628847350 628847321 7.200000e-04 56.5
31 TraesCS7B01G475600 chr4A 80.051 777 136 14 3352 4122 521814456 521815219 4.500000e-155 558.0
32 TraesCS7B01G475600 chr2D 94.395 339 17 2 4808 5145 295643726 295643389 2.120000e-143 520.0
33 TraesCS7B01G475600 chr2D 94.083 338 19 1 4808 5145 490106920 490106584 3.550000e-141 512.0
34 TraesCS7B01G475600 chr6D 93.787 338 20 1 4808 5145 217753872 217753536 1.650000e-139 507.0
35 TraesCS7B01G475600 chr6D 93.491 338 21 1 4808 5145 112654268 112653932 7.690000e-138 501.0
36 TraesCS7B01G475600 chr3A 98.824 85 1 0 1799 1883 54951833 54951917 8.930000e-33 152.0
37 TraesCS7B01G475600 chr3A 85.714 98 12 2 1343 1438 479136862 479136959 9.120000e-18 102.0
38 TraesCS7B01G475600 chr5B 85.606 132 19 0 56 187 36243720 36243851 6.950000e-29 139.0
39 TraesCS7B01G475600 chr2B 79.213 178 30 7 319 491 249419638 249419463 3.260000e-22 117.0
40 TraesCS7B01G475600 chr1B 85.870 92 11 2 1336 1425 395308135 395308044 4.240000e-16 97.1
41 TraesCS7B01G475600 chr6B 78.295 129 25 3 1315 1441 518594952 518595079 4.270000e-11 80.5
42 TraesCS7B01G475600 chr1A 81.481 81 13 2 1286 1365 585820606 585820527 1.200000e-06 65.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G475600 chr7B 731958090 731963236 5146 False 9505.0 9505 100.000000 1 5147 1 chr7B.!!$F1 5146
1 TraesCS7B01G475600 chr7B 732083265 732088993 5728 False 3539.0 6150 99.379000 1 5147 2 chr7B.!!$F3 5146
2 TraesCS7B01G475600 chr7B 732023128 732024758 1630 False 2950.0 2950 99.326000 1397 3026 1 chr7B.!!$F2 1629
3 TraesCS7B01G475600 chrUn 88428164 88431437 3273 False 5895.0 5895 99.175000 1875 5147 1 chrUn.!!$F1 3272
4 TraesCS7B01G475600 chrUn 160380112 160385302 5190 False 4648.5 8030 99.262500 1 5147 2 chrUn.!!$F6 5146
5 TraesCS7B01G475600 chrUn 347938452 347940692 2240 False 4054.0 4054 99.331000 1875 4114 1 chrUn.!!$F3 2239
6 TraesCS7B01G475600 chrUn 435950828 435951956 1128 False 2069.0 2069 99.734000 2716 3844 1 chrUn.!!$F4 1128
7 TraesCS7B01G475600 chrUn 245413640 245416598 2958 False 1764.0 3334 99.602667 545 3497 3 chrUn.!!$F7 2952
8 TraesCS7B01G475600 chrUn 460791113 460792018 905 True 1629.0 1629 99.117000 892 1797 1 chrUn.!!$R2 905
9 TraesCS7B01G475600 chrUn 260933297 260935048 1751 False 1549.0 1829 99.298500 1 1708 2 chrUn.!!$F8 1707
10 TraesCS7B01G475600 chrUn 361665857 361667607 1750 True 1534.5 1829 98.991500 1 1708 2 chrUn.!!$R5 1707
11 TraesCS7B01G475600 chrUn 160316110 160321305 5195 False 1527.0 2929 98.810667 1 5147 3 chrUn.!!$F5 5146
12 TraesCS7B01G475600 chrUn 300935441 300936822 1381 True 1204.5 1247 99.125000 1 1338 2 chrUn.!!$R3 1337
13 TraesCS7B01G475600 chrUn 300954016 300955395 1379 True 1201.0 1240 99.054000 1 1338 2 chrUn.!!$R4 1337
14 TraesCS7B01G475600 chrUn 292554718 292555236 518 False 926.0 926 98.844000 4629 5147 1 chrUn.!!$F2 518
15 TraesCS7B01G475600 chr7D 628830944 628833554 2610 True 1848.5 2795 92.740000 2254 4808 2 chr7D.!!$R2 2554
16 TraesCS7B01G475600 chr4A 521814456 521815219 763 False 558.0 558 80.051000 3352 4122 1 chr4A.!!$F1 770

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
763 811 8.117956 ACTACCGGGAGTATATAATACAATCCA 58.882 37.037 20.82 0.0 0.00 3.41 F
1092 1140 4.373116 GCAAGGTCTCCGTCGGCA 62.373 66.667 6.34 0.0 0.00 5.69 F
2077 2662 1.067000 ACACTGCTCAGCTCACAGATC 60.067 52.381 12.79 0.0 35.38 2.75 F
2446 3034 5.304686 TGTTGACCTTTCAGTAACTCCAT 57.695 39.130 0.00 0.0 31.71 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2077 2662 0.598065 GGCACTGCTTGTTGTTAGGG 59.402 55.000 0.00 0.0 0.0 3.53 R
2714 3302 2.808543 GACACGATATCATCCCCAAAGC 59.191 50.000 3.12 0.0 0.0 3.51 R
3171 3813 4.851639 AGCATCATCTACAACTTCCCTT 57.148 40.909 0.00 0.0 0.0 3.95 R
4381 5027 5.318630 TGGTTAATATATTCCTTTCCGCCC 58.681 41.667 0.00 0.0 0.0 6.13 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
763 811 8.117956 ACTACCGGGAGTATATAATACAATCCA 58.882 37.037 20.82 0.00 0.00 3.41
1092 1140 4.373116 GCAAGGTCTCCGTCGGCA 62.373 66.667 6.34 0.00 0.00 5.69
2077 2662 1.067000 ACACTGCTCAGCTCACAGATC 60.067 52.381 12.79 0.00 35.38 2.75
2446 3034 5.304686 TGTTGACCTTTCAGTAACTCCAT 57.695 39.130 0.00 0.00 31.71 3.41
3171 3813 5.437060 GTGGCCTTTAGATCATCCTTAACA 58.563 41.667 3.32 0.00 0.00 2.41
3844 4487 8.415950 TGGAAAAACAAAGGCTAAAGATATCA 57.584 30.769 5.32 0.00 0.00 2.15
3915 4558 0.594602 GGTCGGTGGCCAAACTTAAC 59.405 55.000 7.24 0.00 0.00 2.01
4074 4718 9.753674 ATTTATGACAATGAGAAAGGGAAACTA 57.246 29.630 0.00 0.00 0.00 2.24
4381 5027 3.442625 GGATGACCATGCCATATCACATG 59.557 47.826 7.29 7.29 42.67 3.21
4535 5181 1.002468 CGTTTCAGTGTCCAAGGCAAG 60.002 52.381 0.00 0.00 0.00 4.01
4739 5385 5.076873 CCCCAATTCCTCAAGTTTAAGTCA 58.923 41.667 0.00 0.00 0.00 3.41
4965 5616 7.831691 TTTGACTCACCAAATGAAGGAATTA 57.168 32.000 0.00 0.00 36.69 1.40
5023 5674 3.623060 CACCCGGAGTATGTTGATTTCAG 59.377 47.826 0.73 0.00 0.00 3.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
215 216 1.705256 GACAACTTCATACGCGTGGA 58.295 50.000 24.59 16.79 0.00 4.02
372 373 4.665212 ACATTGCTCGCATACATTTCAAG 58.335 39.130 0.00 0.00 0.00 3.02
763 811 2.628178 TCCTTCCGTCGCATAATGAGAT 59.372 45.455 0.00 0.00 0.00 2.75
1092 1140 1.698532 GTGGAGGAGGATGATGCTGAT 59.301 52.381 0.00 0.00 0.00 2.90
1948 2533 3.674997 ACCAAGAGTACGCATTTGACAT 58.325 40.909 0.00 0.00 0.00 3.06
2077 2662 0.598065 GGCACTGCTTGTTGTTAGGG 59.402 55.000 0.00 0.00 0.00 3.53
2714 3302 2.808543 GACACGATATCATCCCCAAAGC 59.191 50.000 3.12 0.00 0.00 3.51
3171 3813 4.851639 AGCATCATCTACAACTTCCCTT 57.148 40.909 0.00 0.00 0.00 3.95
3844 4487 6.016943 CCATTTTTCTGGCACAAACAATTGAT 60.017 34.615 13.59 0.00 38.70 2.57
3915 4558 8.110860 ACTTTGTACCTCCAATTATGTTGAAG 57.889 34.615 0.00 0.00 0.00 3.02
4381 5027 5.318630 TGGTTAATATATTCCTTTCCGCCC 58.681 41.667 0.00 0.00 0.00 6.13
4440 5086 8.314143 ACAATTCAAGCCAAAGATGTAAAATG 57.686 30.769 0.00 0.00 0.00 2.32
4535 5181 9.797556 ATACTGGAAAAACTACTTGTCAAAAAC 57.202 29.630 0.00 0.00 0.00 2.43
4708 5354 3.214694 TGAGGAATTGGGGAGGAACTA 57.785 47.619 0.00 0.00 41.55 2.24
4965 5616 4.205587 CCTTTAGCCATGAAGCATCTTCT 58.794 43.478 7.91 0.00 34.23 2.85
5023 5674 6.989169 ACCTAGCAAATCATCTTCATCACTAC 59.011 38.462 0.00 0.00 0.00 2.73


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.