Multiple sequence alignment - TraesCS7B01G466000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G466000 chr7B 100.000 2643 0 0 1 2643 723419767 723422409 0.000000e+00 4881.0
1 TraesCS7B01G466000 chr7B 99.017 2645 13 4 2 2643 723260396 723263030 0.000000e+00 4728.0
2 TraesCS7B01G466000 chr7B 92.428 1730 98 13 174 1872 723734965 723736692 0.000000e+00 2438.0
3 TraesCS7B01G466000 chr7B 90.241 789 49 19 1871 2637 723736726 723737508 0.000000e+00 1005.0
4 TraesCS7B01G466000 chr7B 88.048 753 56 19 1864 2599 722309560 722310295 0.000000e+00 861.0
5 TraesCS7B01G466000 chr7B 88.545 550 32 16 561 1107 722308768 722309289 2.870000e-179 638.0
6 TraesCS7B01G466000 chr7B 90.514 253 14 6 1621 1872 722309290 722309533 2.540000e-85 326.0
7 TraesCS7B01G466000 chr7A 88.804 1304 125 15 582 1877 720641920 720643210 0.000000e+00 1580.0
8 TraesCS7B01G466000 chr7A 89.588 413 42 1 177 588 357348619 357348207 8.380000e-145 523.0
9 TraesCS7B01G466000 chr7A 82.222 135 11 9 2327 2458 97403360 97403484 1.290000e-18 104.0
10 TraesCS7B01G466000 chrUn 89.286 1148 108 10 747 1883 333065805 333064662 0.000000e+00 1424.0
11 TraesCS7B01G466000 chrUn 89.405 1142 106 10 747 1877 372321095 372322232 0.000000e+00 1424.0
12 TraesCS7B01G466000 chr7D 89.405 1142 106 10 747 1877 624835138 624836275 0.000000e+00 1424.0
13 TraesCS7B01G466000 chr7D 89.588 413 42 1 177 588 534471378 534470966 8.380000e-145 523.0
14 TraesCS7B01G466000 chr1D 91.795 390 31 1 174 562 411572231 411572620 2.310000e-150 542.0
15 TraesCS7B01G466000 chr1D 97.765 179 4 0 1 179 431227370 431227548 2.560000e-80 309.0
16 TraesCS7B01G466000 chr1D 79.434 389 56 18 2094 2462 279521451 279521835 1.210000e-63 254.0
17 TraesCS7B01G466000 chr6D 90.315 413 39 1 177 588 160204770 160204358 8.320000e-150 540.0
18 TraesCS7B01G466000 chr6D 95.288 191 7 2 1 190 66826463 66826274 4.280000e-78 302.0
19 TraesCS7B01G466000 chr6D 100.000 29 0 0 2576 2604 471812048 471812020 1.000000e-03 54.7
20 TraesCS7B01G466000 chr6D 100.000 29 0 0 2576 2604 472043690 472043718 1.000000e-03 54.7
21 TraesCS7B01G466000 chr5A 89.904 416 41 1 174 588 483276209 483276624 3.870000e-148 534.0
22 TraesCS7B01G466000 chr4D 89.904 416 41 1 174 588 313597373 313597788 3.870000e-148 534.0
23 TraesCS7B01G466000 chr4D 100.000 30 0 0 2574 2603 421983990 421983961 3.680000e-04 56.5
24 TraesCS7B01G466000 chr1B 89.639 415 40 3 174 586 574237742 574238155 2.330000e-145 525.0
25 TraesCS7B01G466000 chr1B 85.542 83 10 2 2290 2371 379627126 379627045 4.690000e-13 86.1
26 TraesCS7B01G466000 chr1B 85.915 71 7 3 2568 2637 64290212 64290280 3.650000e-09 73.1
27 TraesCS7B01G466000 chr6B 98.857 175 2 0 1 175 669430296 669430122 1.980000e-81 313.0
28 TraesCS7B01G466000 chr5B 96.335 191 5 2 1 190 447458059 447457870 1.980000e-81 313.0
29 TraesCS7B01G466000 chr5B 95.288 191 7 2 1 190 156188809 156188998 4.280000e-78 302.0
30 TraesCS7B01G466000 chr5B 90.909 66 6 0 2578 2643 455879493 455879428 3.620000e-14 89.8
31 TraesCS7B01G466000 chr2D 97.765 179 4 0 1 179 89170773 89170951 2.560000e-80 309.0
32 TraesCS7B01G466000 chr2D 92.188 64 3 2 2576 2638 512906225 512906287 3.620000e-14 89.8
33 TraesCS7B01G466000 chr2D 91.228 57 5 0 2576 2632 370825510 370825566 7.840000e-11 78.7
34 TraesCS7B01G466000 chr2D 89.655 58 4 2 2576 2632 537210496 537210440 3.650000e-09 73.1
35 TraesCS7B01G466000 chr2D 87.755 49 2 4 2576 2623 634559384 634559339 1.000000e-03 54.7
36 TraesCS7B01G466000 chr5D 95.288 191 7 2 1 190 152536321 152536510 4.280000e-78 302.0
37 TraesCS7B01G466000 chr5D 94.340 53 2 1 2580 2632 562078827 562078776 2.180000e-11 80.5
38 TraesCS7B01G466000 chr5D 90.698 43 2 2 2576 2617 212199407 212199448 3.680000e-04 56.5
39 TraesCS7B01G466000 chr3B 95.288 191 7 2 1 190 480352334 480352145 4.280000e-78 302.0
40 TraesCS7B01G466000 chr3B 79.139 302 45 13 2165 2458 15669361 15669652 2.680000e-45 193.0
41 TraesCS7B01G466000 chr3B 77.850 307 47 16 2165 2458 25678503 25678205 1.260000e-38 171.0
42 TraesCS7B01G466000 chr3B 92.063 63 5 0 2574 2636 107320757 107320819 3.620000e-14 89.8
43 TraesCS7B01G466000 chr3D 79.381 388 52 22 2094 2458 11154552 11154170 5.650000e-62 248.0
44 TraesCS7B01G466000 chr3D 91.803 61 5 0 2576 2636 420445640 420445580 4.690000e-13 86.1
45 TraesCS7B01G466000 chr3D 90.164 61 6 0 2576 2636 44886807 44886867 2.180000e-11 80.5
46 TraesCS7B01G466000 chr3D 100.000 28 0 0 2576 2603 389078615 389078642 5.000000e-03 52.8
47 TraesCS7B01G466000 chr3D 100.000 28 0 0 2578 2605 585988718 585988745 5.000000e-03 52.8
48 TraesCS7B01G466000 chr1A 80.537 149 19 8 2306 2449 351604348 351604205 3.600000e-19 106.0
49 TraesCS7B01G466000 chr1A 84.615 65 6 3 2576 2638 149629271 149629209 7.900000e-06 62.1
50 TraesCS7B01G466000 chr4B 91.667 60 5 0 2575 2634 451879894 451879953 1.690000e-12 84.2
51 TraesCS7B01G466000 chr4B 89.831 59 6 0 2579 2637 640529393 640529451 2.820000e-10 76.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G466000 chr7B 723419767 723422409 2642 False 4881.000000 4881 100.000000 1 2643 1 chr7B.!!$F2 2642
1 TraesCS7B01G466000 chr7B 723260396 723263030 2634 False 4728.000000 4728 99.017000 2 2643 1 chr7B.!!$F1 2641
2 TraesCS7B01G466000 chr7B 723734965 723737508 2543 False 1721.500000 2438 91.334500 174 2637 2 chr7B.!!$F4 2463
3 TraesCS7B01G466000 chr7B 722308768 722310295 1527 False 608.333333 861 89.035667 561 2599 3 chr7B.!!$F3 2038
4 TraesCS7B01G466000 chr7A 720641920 720643210 1290 False 1580.000000 1580 88.804000 582 1877 1 chr7A.!!$F2 1295
5 TraesCS7B01G466000 chrUn 333064662 333065805 1143 True 1424.000000 1424 89.286000 747 1883 1 chrUn.!!$R1 1136
6 TraesCS7B01G466000 chrUn 372321095 372322232 1137 False 1424.000000 1424 89.405000 747 1877 1 chrUn.!!$F1 1130
7 TraesCS7B01G466000 chr7D 624835138 624836275 1137 False 1424.000000 1424 89.405000 747 1877 1 chr7D.!!$F1 1130

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
45 46 2.834113 AGGGCAACAGGTAGTATCTGT 58.166 47.619 10.43 10.43 46.22 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1816 1864 1.674322 CCGTTGGGCGTGGATCTTT 60.674 57.895 0.0 0.0 39.32 2.52 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
45 46 2.834113 AGGGCAACAGGTAGTATCTGT 58.166 47.619 10.43 10.43 46.22 3.41
912 936 6.124316 AGATATCATGCAATAAGAGTGCCT 57.876 37.500 5.32 0.00 41.49 4.75
1217 1245 2.024414 AGTTTGCGCTTTTTGTCCTCT 58.976 42.857 9.73 0.00 0.00 3.69
1816 1864 8.266363 ACGGTAATGTTTCTAGGGGAATATTA 57.734 34.615 0.00 0.00 33.53 0.98
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
0 1 1.940613 GGGATAATGGTCAAGCACGTC 59.059 52.381 0.0 0.0 0.00 4.34
34 35 6.149129 TGTGATGATGACACAGATACTACC 57.851 41.667 0.0 0.0 42.20 3.18
912 936 5.470368 ACGTCTCATTTTTCAGATCTTCGA 58.530 37.500 0.0 0.0 0.00 3.71
1816 1864 1.674322 CCGTTGGGCGTGGATCTTT 60.674 57.895 0.0 0.0 39.32 2.52
2088 2172 2.156917 CAAGAGCATGTGAGCTTCCAA 58.843 47.619 0.0 0.0 46.75 3.53


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.