Multiple sequence alignment - TraesCS7B01G461400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G461400 chr7B 100.000 3993 0 0 1 3993 718596024 718600016 0.000000e+00 7374.0
1 TraesCS7B01G461400 chr7B 99.775 3113 7 0 1 3113 718572534 718575646 0.000000e+00 5710.0
2 TraesCS7B01G461400 chr7B 97.616 881 20 1 3114 3993 718577787 718578667 0.000000e+00 1509.0
3 TraesCS7B01G461400 chr7B 96.942 883 25 2 3113 3993 718511186 718512068 0.000000e+00 1480.0
4 TraesCS7B01G461400 chr7B 100.000 364 0 0 2750 3113 718508683 718509046 0.000000e+00 673.0
5 TraesCS7B01G461400 chr7B 77.353 967 183 23 1860 2811 677963285 677964230 1.260000e-149 540.0
6 TraesCS7B01G461400 chr7B 77.985 536 94 19 951 1479 690199619 690200137 8.330000e-82 315.0
7 TraesCS7B01G461400 chr7B 89.447 199 18 3 1 197 719869049 719869246 8.570000e-62 248.0
8 TraesCS7B01G461400 chr7D 95.165 3144 103 14 1 3113 621315246 621312121 0.000000e+00 4918.0
9 TraesCS7B01G461400 chr7D 91.620 358 25 4 320 674 621310720 621310365 1.290000e-134 490.0
10 TraesCS7B01G461400 chr7D 76.389 720 120 28 772 1479 606301604 606302285 3.820000e-90 342.0
11 TraesCS7B01G461400 chr7D 81.731 416 57 11 3128 3532 597910043 597910450 2.970000e-86 329.0
12 TraesCS7B01G461400 chr7D 79.295 454 63 20 1819 2251 606303654 606304097 5.050000e-74 289.0
13 TraesCS7B01G461400 chr7D 80.000 395 62 12 1866 2251 605958288 605958674 3.930000e-70 276.0
14 TraesCS7B01G461400 chr7D 91.500 200 17 0 1 200 622089116 622089315 3.930000e-70 276.0
15 TraesCS7B01G461400 chr7D 79.397 398 63 13 1864 2251 606108884 606109272 3.060000e-66 263.0
16 TraesCS7B01G461400 chr7D 78.961 385 62 15 1864 2239 606183495 606183869 1.110000e-60 244.0
17 TraesCS7B01G461400 chr7D 78.616 159 20 9 1672 1823 606303222 606303373 4.250000e-15 93.5
18 TraesCS7B01G461400 chr7A 93.607 3144 133 20 1 3113 716502508 716505614 0.000000e+00 4630.0
19 TraesCS7B01G461400 chr7A 92.915 2724 124 22 430 3113 716608823 716606129 0.000000e+00 3897.0
20 TraesCS7B01G461400 chr7A 80.579 932 128 26 3114 3993 716604005 716603075 0.000000e+00 669.0
21 TraesCS7B01G461400 chr7A 91.292 356 25 5 323 674 716604749 716604396 7.760000e-132 481.0
22 TraesCS7B01G461400 chr7A 91.011 356 26 5 323 674 716507013 716507366 3.610000e-130 475.0
23 TraesCS7B01G461400 chr7A 80.238 420 62 13 3114 3522 460720229 460720638 3.020000e-76 296.0
24 TraesCS7B01G461400 chr7A 97.101 69 2 0 1 69 716608882 716608814 2.520000e-22 117.0
25 TraesCS7B01G461400 chrUn 99.268 2186 15 1 1 2186 329802189 329800005 0.000000e+00 3947.0
26 TraesCS7B01G461400 chrUn 99.492 1181 5 1 1006 2186 429197404 429198583 0.000000e+00 2146.0
27 TraesCS7B01G461400 chrUn 99.193 991 8 0 1 991 384893764 384892774 0.000000e+00 1786.0
28 TraesCS7B01G461400 chrUn 97.169 883 23 2 3113 3993 293898336 293899218 0.000000e+00 1491.0
29 TraesCS7B01G461400 chrUn 100.000 364 0 0 2750 3113 270666414 270666777 0.000000e+00 673.0
30 TraesCS7B01G461400 chrUn 100.000 364 0 0 2750 3113 293895833 293896196 0.000000e+00 673.0
31 TraesCS7B01G461400 chr3A 74.684 1106 210 44 2022 3113 704579253 704580302 1.030000e-115 427.0
32 TraesCS7B01G461400 chr3A 78.041 633 98 30 865 1479 704695793 704695184 1.050000e-95 361.0
33 TraesCS7B01G461400 chr3A 77.496 631 105 27 865 1479 704571194 704571803 1.060000e-90 344.0
34 TraesCS7B01G461400 chr3A 82.540 189 28 3 2929 3116 704777948 704777764 1.150000e-35 161.0
35 TraesCS7B01G461400 chr1B 81.295 417 60 10 3114 3521 457000185 457000592 4.980000e-84 322.0
36 TraesCS7B01G461400 chr1B 76.976 291 39 9 3674 3936 361008544 361008254 1.500000e-29 141.0
37 TraesCS7B01G461400 chr5B 81.572 407 58 12 3136 3535 706484704 706484308 1.790000e-83 320.0
38 TraesCS7B01G461400 chr5B 80.240 167 33 0 3760 3926 528109946 528109780 4.190000e-25 126.0
39 TraesCS7B01G461400 chr5B 96.078 51 2 0 150 200 563865215 563865265 2.560000e-12 84.2
40 TraesCS7B01G461400 chr2D 81.235 421 55 16 3114 3522 289011008 289011416 6.440000e-83 318.0
41 TraesCS7B01G461400 chr2D 92.771 83 6 0 3671 3753 59824189 59824271 1.950000e-23 121.0
42 TraesCS7B01G461400 chr5D 80.760 421 60 12 3128 3535 390629026 390628614 3.880000e-80 309.0
43 TraesCS7B01G461400 chr5D 73.632 402 64 23 3363 3740 533994865 533995248 2.520000e-22 117.0
44 TraesCS7B01G461400 chr5D 96.078 51 2 0 150 200 459578308 459578358 2.560000e-12 84.2
45 TraesCS7B01G461400 chr5D 94.286 35 2 0 3918 3952 430972441 430972407 2.000000e-03 54.7
46 TraesCS7B01G461400 chr2A 79.376 417 65 14 3128 3532 16569867 16570274 1.410000e-69 274.0
47 TraesCS7B01G461400 chr2A 76.991 226 48 4 3769 3993 19350898 19351120 4.190000e-25 126.0
48 TraesCS7B01G461400 chr2A 79.310 116 24 0 3878 3993 304983963 304984078 9.200000e-12 82.4
49 TraesCS7B01G461400 chr1D 73.763 465 96 17 3114 3572 110838845 110839289 4.130000e-35 159.0
50 TraesCS7B01G461400 chr1D 93.750 80 5 0 3674 3753 443187267 443187346 1.950000e-23 121.0
51 TraesCS7B01G461400 chr5A 79.204 226 47 0 3757 3982 380233619 380233844 1.490000e-34 158.0
52 TraesCS7B01G461400 chr5A 92.000 50 2 2 3760 3808 267117433 267117385 7.160000e-08 69.4
53 TraesCS7B01G461400 chr1A 91.250 80 7 0 3674 3753 374245747 374245826 4.220000e-20 110.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G461400 chr7B 718596024 718600016 3992 False 7374.0 7374 100.00000 1 3993 1 chr7B.!!$F3 3992
1 TraesCS7B01G461400 chr7B 718572534 718578667 6133 False 3609.5 5710 98.69550 1 3993 2 chr7B.!!$F6 3992
2 TraesCS7B01G461400 chr7B 718508683 718512068 3385 False 1076.5 1480 98.47100 2750 3993 2 chr7B.!!$F5 1243
3 TraesCS7B01G461400 chr7B 677963285 677964230 945 False 540.0 540 77.35300 1860 2811 1 chr7B.!!$F1 951
4 TraesCS7B01G461400 chr7B 690199619 690200137 518 False 315.0 315 77.98500 951 1479 1 chr7B.!!$F2 528
5 TraesCS7B01G461400 chr7D 621310365 621315246 4881 True 2704.0 4918 93.39250 1 3113 2 chr7D.!!$R1 3112
6 TraesCS7B01G461400 chr7D 606301604 606304097 2493 False 241.5 342 78.10000 772 2251 3 chr7D.!!$F6 1479
7 TraesCS7B01G461400 chr7A 716502508 716507366 4858 False 2552.5 4630 92.30900 1 3113 2 chr7A.!!$F2 3112
8 TraesCS7B01G461400 chr7A 716603075 716608882 5807 True 1291.0 3897 90.47175 1 3993 4 chr7A.!!$R1 3992
9 TraesCS7B01G461400 chrUn 329800005 329802189 2184 True 3947.0 3947 99.26800 1 2186 1 chrUn.!!$R1 2185
10 TraesCS7B01G461400 chrUn 429197404 429198583 1179 False 2146.0 2146 99.49200 1006 2186 1 chrUn.!!$F2 1180
11 TraesCS7B01G461400 chrUn 384892774 384893764 990 True 1786.0 1786 99.19300 1 991 1 chrUn.!!$R2 990
12 TraesCS7B01G461400 chrUn 293895833 293899218 3385 False 1082.0 1491 98.58450 2750 3993 2 chrUn.!!$F3 1243
13 TraesCS7B01G461400 chr3A 704579253 704580302 1049 False 427.0 427 74.68400 2022 3113 1 chr3A.!!$F2 1091
14 TraesCS7B01G461400 chr3A 704695184 704695793 609 True 361.0 361 78.04100 865 1479 1 chr3A.!!$R1 614
15 TraesCS7B01G461400 chr3A 704571194 704571803 609 False 344.0 344 77.49600 865 1479 1 chr3A.!!$F1 614

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2637 3875 5.300539 AGACAGTATCGCAAGTCATCTACAT 59.699 40.0 0.0 0.0 39.48 2.29 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
3890 7374 1.716028 GGTGGGGAGAACAACAGGGT 61.716 60.0 0.0 0.0 0.0 4.34 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
2637 3875 5.300539 AGACAGTATCGCAAGTCATCTACAT 59.699 40.000 0.0 0.0 39.48 2.29
3126 6558 3.480133 GATGTAGCCGCCCCCACT 61.480 66.667 0.0 0.0 0.00 4.00
3344 6781 3.430862 GGTTTGCATCGCTCGCCA 61.431 61.111 0.0 0.0 0.00 5.69
3881 7365 4.393155 TTGCCTCATCGTGCCGCT 62.393 61.111 0.0 0.0 0.00 5.52
3957 7441 2.771943 ACATCACCCATTCAGGACGTAT 59.228 45.455 0.0 0.0 41.22 3.06
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
976 1046 5.245301 TGTTCTCCGAAATTCTTCTCACCTA 59.755 40.000 0.00 0.00 0.0 3.08
3156 6588 2.261361 CAGTCATGACGGCCGACA 59.739 61.111 35.90 33.24 36.2 4.35
3361 6798 1.688772 GGTATCGGAGTAGAGGTGCA 58.311 55.000 0.00 0.00 0.0 4.57
3890 7374 1.716028 GGTGGGGAGAACAACAGGGT 61.716 60.000 0.00 0.00 0.0 4.34
3957 7441 2.842188 TAGACCGCGGGCCTTGACTA 62.842 60.000 31.68 9.85 0.0 2.59


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.