Multiple sequence alignment - TraesCS7B01G458600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G458600 chr7B 100.000 3394 0 0 1 3394 716910712 716907319 0 6268
1 TraesCS7B01G458600 chr7B 98.998 3394 33 1 1 3394 742954451 742957843 0 6078
2 TraesCS7B01G458600 chr7B 98.969 3394 34 1 1 3394 716778895 716775503 0 6072
3 TraesCS7B01G458600 chr7A 99.086 3393 30 1 1 3392 60349347 60345955 0 6093
4 TraesCS7B01G458600 chr5A 99.028 3394 33 0 1 3394 16538869 16535476 0 6085
5 TraesCS7B01G458600 chr2B 98.763 3395 40 2 1 3394 391172731 391169338 0 6035
6 TraesCS7B01G458600 chr1B 98.645 3394 45 1 1 3394 583567261 583570653 0 6011
7 TraesCS7B01G458600 chr3B 97.998 3397 65 1 1 3394 39847343 39843947 0 5893


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G458600 chr7B 716907319 716910712 3393 True 6268 6268 100.000 1 3394 1 chr7B.!!$R2 3393
1 TraesCS7B01G458600 chr7B 742954451 742957843 3392 False 6078 6078 98.998 1 3394 1 chr7B.!!$F1 3393
2 TraesCS7B01G458600 chr7B 716775503 716778895 3392 True 6072 6072 98.969 1 3394 1 chr7B.!!$R1 3393
3 TraesCS7B01G458600 chr7A 60345955 60349347 3392 True 6093 6093 99.086 1 3392 1 chr7A.!!$R1 3391
4 TraesCS7B01G458600 chr5A 16535476 16538869 3393 True 6085 6085 99.028 1 3394 1 chr5A.!!$R1 3393
5 TraesCS7B01G458600 chr2B 391169338 391172731 3393 True 6035 6035 98.763 1 3394 1 chr2B.!!$R1 3393
6 TraesCS7B01G458600 chr1B 583567261 583570653 3392 False 6011 6011 98.645 1 3394 1 chr1B.!!$F1 3393
7 TraesCS7B01G458600 chr3B 39843947 39847343 3396 True 5893 5893 97.998 1 3394 1 chr3B.!!$R1 3393

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
220 221 2.696187 GCCAAAACTTTCCTTGGGTACA 59.304 45.455 0.0 0.0 42.08 2.90 F
1111 1116 5.999205 ATTCATTGCAGGTTGGTTATTCA 57.001 34.783 0.0 0.0 0.00 2.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1111 1116 0.962356 CAAGTGAAAGCCGGGCTGAT 60.962 55.000 24.63 15.13 39.62 2.90 R
2685 2690 3.323979 TCAAAGTCCTCAGTAGGTGGTTC 59.676 47.826 0.00 0.00 44.09 3.62 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
45 46 8.537858 TCTGATAGATCAACATATCCATGAAGG 58.462 37.037 0.00 0.0 36.18 3.46
220 221 2.696187 GCCAAAACTTTCCTTGGGTACA 59.304 45.455 0.00 0.0 42.08 2.90
1111 1116 5.999205 ATTCATTGCAGGTTGGTTATTCA 57.001 34.783 0.00 0.0 0.00 2.57
1417 1422 5.242615 AGCTAAGAGAGATGTCGCATAATCA 59.757 40.000 0.00 0.0 0.00 2.57
1635 1640 1.217183 ACCCTGAGTCGGCTATTCCTA 59.783 52.381 0.00 0.0 0.00 2.94
1748 1753 0.595567 AACGCTTTCGAGCACGTACA 60.596 50.000 2.86 0.0 37.87 2.90
2685 2690 2.874701 CAGATAGGCATTTGAAGGACCG 59.125 50.000 0.00 0.0 0.00 4.79
2955 2960 3.575965 ATTCAATTGACAAAGCGTCCC 57.424 42.857 7.89 0.0 44.71 4.46
3234 3239 1.135170 GTGCGGGGAACTCTACACTAC 60.135 57.143 0.00 0.0 0.00 2.73
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
45 46 1.134068 GGTGGATAGGGTCAGCCTTTC 60.134 57.143 0.00 1.97 34.45 2.62
220 221 4.942761 ACCTGCTTTGAACATGACATTT 57.057 36.364 0.00 0.00 0.00 2.32
1098 1103 2.683742 CGGGCTGATGAATAACCAACCT 60.684 50.000 0.00 0.00 0.00 3.50
1111 1116 0.962356 CAAGTGAAAGCCGGGCTGAT 60.962 55.000 24.63 15.13 39.62 2.90
1635 1640 5.716703 CCCACATACCTTTCCTTTCTGAATT 59.283 40.000 0.00 0.00 0.00 2.17
1748 1753 2.593346 CTCTATCAAAGAGCGCCAGT 57.407 50.000 2.29 0.00 45.22 4.00
2497 2502 5.905733 CGTGTCGTTATTCTGTATCGTGTAT 59.094 40.000 0.00 0.00 0.00 2.29
2685 2690 3.323979 TCAAAGTCCTCAGTAGGTGGTTC 59.676 47.826 0.00 0.00 44.09 3.62
3234 3239 6.154203 TGAAGGAATAGCATCTGAGTACAG 57.846 41.667 0.00 0.00 44.66 2.74


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.