Multiple sequence alignment - TraesCS7B01G458500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G458500 chr7B 100.000 2960 0 0 1 2960 716881821 716884780 0 5467
1 TraesCS7B01G458500 chr7A 98.987 2961 26 4 1 2960 60276273 60273316 0 5299
2 TraesCS7B01G458500 chr7A 98.784 2961 32 4 1 2960 120844192 120847149 0 5265
3 TraesCS7B01G458500 chr2B 98.784 2960 34 2 1 2960 391079892 391082849 0 5265
4 TraesCS7B01G458500 chr7D 98.784 2960 31 2 1 2960 381976796 381979750 0 5262
5 TraesCS7B01G458500 chr7D 98.649 2960 35 2 1 2960 203496965 203494011 0 5240
6 TraesCS7B01G458500 chr7D 98.582 2961 36 3 1 2960 381916944 381913989 0 5230


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G458500 chr7B 716881821 716884780 2959 False 5467 5467 100.000 1 2960 1 chr7B.!!$F1 2959
1 TraesCS7B01G458500 chr7A 60273316 60276273 2957 True 5299 5299 98.987 1 2960 1 chr7A.!!$R1 2959
2 TraesCS7B01G458500 chr7A 120844192 120847149 2957 False 5265 5265 98.784 1 2960 1 chr7A.!!$F1 2959
3 TraesCS7B01G458500 chr2B 391079892 391082849 2957 False 5265 5265 98.784 1 2960 1 chr2B.!!$F1 2959
4 TraesCS7B01G458500 chr7D 381976796 381979750 2954 False 5262 5262 98.784 1 2960 1 chr7D.!!$F1 2959
5 TraesCS7B01G458500 chr7D 203494011 203496965 2954 True 5240 5240 98.649 1 2960 1 chr7D.!!$R1 2959
6 TraesCS7B01G458500 chr7D 381913989 381916944 2955 True 5230 5230 98.582 1 2960 1 chr7D.!!$R2 2959

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
205 206 4.225492 TGGACGACCCTCAAAACCATAATA 59.775 41.667 0.34 0.0 35.38 0.98 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2164 2166 0.976641 AGGCTTCTGTCGGATTCACA 59.023 50.0 0.0 0.0 0.0 3.58 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
186 187 5.932883 AGAGGAAAGTCTTTTCGTAATGGAC 59.067 40.000 0.00 0.0 42.93 4.02
205 206 4.225492 TGGACGACCCTCAAAACCATAATA 59.775 41.667 0.34 0.0 35.38 0.98
797 798 8.473358 TTTTAGAGTTATGTATCCAGGATCGA 57.527 34.615 4.75 0.0 0.00 3.59
1553 1555 5.154222 GTTTCTACAATACAAAGCACCAGC 58.846 41.667 0.00 0.0 42.56 4.85
1628 1630 1.075374 TGTTCAGCCCAAAGGTGCTAT 59.925 47.619 0.00 0.0 43.95 2.97
1913 1915 5.251700 GGGGGTCTGATCCTGATACATTATT 59.748 44.000 6.95 0.0 0.00 1.40
2141 2143 2.948979 TGTTTAGTTGAGTGTGGGCTTG 59.051 45.455 0.00 0.0 0.00 4.01
2164 2166 0.613260 TACCAAATGCTCTGGCTCGT 59.387 50.000 0.00 0.0 37.48 4.18
2951 2956 7.504924 AAGTTCGTCAAAGGATTGTTTATGA 57.495 32.000 0.00 0.0 37.79 2.15
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
186 187 6.317642 TCAACATATTATGGTTTTGAGGGTCG 59.682 38.462 8.48 0.00 33.60 4.79
194 195 8.447833 CGCCGTATATCAACATATTATGGTTTT 58.552 33.333 8.48 0.00 33.60 2.43
205 206 4.624024 CGGATTTACGCCGTATATCAACAT 59.376 41.667 22.91 0.00 43.66 2.71
797 798 3.407424 TTCAACACTAGAGCATGCAGT 57.593 42.857 21.98 12.09 0.00 4.40
1553 1555 2.567615 ACTGCTTCCACCTTACCACTAG 59.432 50.000 0.00 0.00 0.00 2.57
1913 1915 6.211584 GCATAAGTAACCTCCTATCAGATCCA 59.788 42.308 0.00 0.00 0.00 3.41
2020 2022 6.882610 TCACACATCTGCTTGTATTCTTTT 57.117 33.333 0.00 0.00 0.00 2.27
2141 2143 3.670627 CGAGCCAGAGCATTTGGTAAAAC 60.671 47.826 3.55 0.00 43.56 2.43
2164 2166 0.976641 AGGCTTCTGTCGGATTCACA 59.023 50.000 0.00 0.00 0.00 3.58


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.