Multiple sequence alignment - TraesCS7B01G458300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G458300 chr7B 100.000 2594 0 0 1 2594 716878814 716876221 0 4791
1 TraesCS7B01G458300 chr5A 99.270 2601 12 3 1 2594 19248878 19246278 0 4691
2 TraesCS7B01G458300 chr7D 99.115 2600 17 2 1 2594 381923967 381926566 0 4669
3 TraesCS7B01G458300 chr7D 99.077 2601 17 3 1 2594 382050044 382052644 0 4663
4 TraesCS7B01G458300 chr7D 99.038 2600 19 2 1 2594 203499965 203502564 0 4658
5 TraesCS7B01G458300 chr7D 98.925 2605 14 4 1 2594 381973801 381971200 0 4643
6 TraesCS7B01G458300 chr7A 98.998 2595 25 1 1 2594 60279279 60281873 0 4647
7 TraesCS7B01G458300 chr1A 98.998 2595 25 1 1 2594 498691261 498688667 0 4647


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G458300 chr7B 716876221 716878814 2593 True 4791 4791 100.000 1 2594 1 chr7B.!!$R1 2593
1 TraesCS7B01G458300 chr5A 19246278 19248878 2600 True 4691 4691 99.270 1 2594 1 chr5A.!!$R1 2593
2 TraesCS7B01G458300 chr7D 381923967 381926566 2599 False 4669 4669 99.115 1 2594 1 chr7D.!!$F2 2593
3 TraesCS7B01G458300 chr7D 382050044 382052644 2600 False 4663 4663 99.077 1 2594 1 chr7D.!!$F3 2593
4 TraesCS7B01G458300 chr7D 203499965 203502564 2599 False 4658 4658 99.038 1 2594 1 chr7D.!!$F1 2593
5 TraesCS7B01G458300 chr7D 381971200 381973801 2601 True 4643 4643 98.925 1 2594 1 chr7D.!!$R1 2593
6 TraesCS7B01G458300 chr7A 60279279 60281873 2594 False 4647 4647 98.998 1 2594 1 chr7A.!!$F1 2593
7 TraesCS7B01G458300 chr1A 498688667 498691261 2594 True 4647 4647 98.998 1 2594 1 chr1A.!!$R1 2593

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
392 394 1.834822 TTCACCCGGGGCCAAAAAG 60.835 57.895 27.92 3.79 0.0 2.27 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2310 2321 0.804364 CATTGCAGCAGAGCCGTTTA 59.196 50.0 0.0 0.0 0.0 2.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
392 394 1.834822 TTCACCCGGGGCCAAAAAG 60.835 57.895 27.92 3.79 0.00 2.27
1285 1291 5.887598 TCATGTGGAACCATAGAAGGAATTG 59.112 40.000 0.00 0.00 34.36 2.32
2047 2053 7.009179 TGAAGAAATAAGAGGAGAGCAAAGA 57.991 36.000 0.00 0.00 0.00 2.52
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
339 341 1.052617 GATTGGAGGGGTCCTAGCTC 58.947 60.000 0.00 0.00 31.76 4.09
392 394 0.183731 AGGCATTCCGGAATTCTCCC 59.816 55.000 27.21 21.90 38.71 4.30
621 624 3.808466 TTGTTTATGTTGTTGCCAGCA 57.192 38.095 0.00 0.00 36.18 4.41
639 642 1.755179 CAGCTACATGGACCCCTTTG 58.245 55.000 0.00 0.00 0.00 2.77
1970 1976 1.967779 CCCAACGAAAATGGAAAGGGT 59.032 47.619 0.00 0.00 40.56 4.34
2310 2321 0.804364 CATTGCAGCAGAGCCGTTTA 59.196 50.000 0.00 0.00 0.00 2.01
2387 2398 4.579753 GTGTAGTAGTAGGCACTTCTAGGG 59.420 50.000 0.00 0.00 38.96 3.53
2462 2478 0.243636 GATTGAAGCCCCCAACGTTG 59.756 55.000 21.47 21.47 0.00 4.10


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.