Multiple sequence alignment - TraesCS7B01G458200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G458200 chr7B 100.000 2713 0 0 1 2713 716875314 716878026 0 5011
1 TraesCS7B01G458200 chr7B 98.968 2714 26 2 1 2713 742992912 742990200 0 4855
2 TraesCS7B01G458200 chr7B 98.749 2717 30 1 1 2713 716835099 716837815 0 4826
3 TraesCS7B01G458200 chr5A 99.411 2718 11 1 1 2713 19245371 19248088 0 4926
4 TraesCS7B01G458200 chr7D 99.154 2718 16 2 1 2713 382053549 382050834 0 4885
5 TraesCS7B01G458200 chr7D 99.006 2717 20 2 2 2713 381927470 381924756 0 4861
6 TraesCS7B01G458200 chr7D 98.933 2718 22 2 1 2713 203503469 203500754 0 4852
7 TraesCS7B01G458200 chr7D 98.898 2723 16 4 1 2713 381970294 381973012 0 4850
8 TraesCS7B01G458200 chrUn 99.115 2711 24 0 1 2711 186204954 186207664 0 4874
9 TraesCS7B01G458200 chr1A 99.042 2713 25 1 1 2713 498687761 498690472 0 4865


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G458200 chr7B 716875314 716878026 2712 False 5011 5011 100.000 1 2713 1 chr7B.!!$F2 2712
1 TraesCS7B01G458200 chr7B 742990200 742992912 2712 True 4855 4855 98.968 1 2713 1 chr7B.!!$R1 2712
2 TraesCS7B01G458200 chr7B 716835099 716837815 2716 False 4826 4826 98.749 1 2713 1 chr7B.!!$F1 2712
3 TraesCS7B01G458200 chr5A 19245371 19248088 2717 False 4926 4926 99.411 1 2713 1 chr5A.!!$F1 2712
4 TraesCS7B01G458200 chr7D 382050834 382053549 2715 True 4885 4885 99.154 1 2713 1 chr7D.!!$R3 2712
5 TraesCS7B01G458200 chr7D 381924756 381927470 2714 True 4861 4861 99.006 2 2713 1 chr7D.!!$R2 2711
6 TraesCS7B01G458200 chr7D 203500754 203503469 2715 True 4852 4852 98.933 1 2713 1 chr7D.!!$R1 2712
7 TraesCS7B01G458200 chr7D 381970294 381973012 2718 False 4850 4850 98.898 1 2713 1 chr7D.!!$F1 2712
8 TraesCS7B01G458200 chrUn 186204954 186207664 2710 False 4874 4874 99.115 1 2711 1 chrUn.!!$F1 2710
9 TraesCS7B01G458200 chr1A 498687761 498690472 2711 False 4865 4865 99.042 1 2713 1 chr1A.!!$F1 2712

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
593 594 1.251527 GCTGAGTCCTCTCCGAACCA 61.252 60.0 0.0 0.0 39.75 3.67 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2215 2230 5.887598 TCATGTGGAACCATAGAAGGAATTG 59.112 40.0 0.0 0.0 34.36 2.32 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
335 336 4.384940 TGAACCTTGTCAATGATCGAACA 58.615 39.130 0.00 0.00 0.00 3.18
593 594 1.251527 GCTGAGTCCTCTCCGAACCA 61.252 60.000 0.00 0.00 39.75 3.67
876 877 2.494888 TCTTATCCATCTCTGCCCCA 57.505 50.000 0.00 0.00 0.00 4.96
1038 1039 0.243636 GATTGAAGCCCCCAACGTTG 59.756 55.000 21.47 21.47 0.00 4.10
1113 1119 4.579753 GTGTAGTAGTAGGCACTTCTAGGG 59.420 50.000 0.00 0.00 38.96 3.53
1190 1196 0.804364 CATTGCAGCAGAGCCGTTTA 59.196 50.000 0.00 0.00 0.00 2.01
1530 1545 1.967779 CCCAACGAAAATGGAAAGGGT 59.032 47.619 0.00 0.00 40.56 4.34
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
335 336 6.595716 GGCACTCAGTTCATATCTGTAAGTTT 59.404 38.462 0.0 0.0 34.86 2.66
876 877 2.188817 GGTCTCTACCCACATGGAAGT 58.811 52.381 0.0 0.0 40.21 3.01
889 890 5.193930 TCTTCATTCTCTACAGGGGTCTCTA 59.806 44.000 0.0 0.0 0.00 2.43
1453 1468 7.009179 TGAAGAAATAAGAGGAGAGCAAAGA 57.991 36.000 0.0 0.0 0.00 2.52
2215 2230 5.887598 TCATGTGGAACCATAGAAGGAATTG 59.112 40.000 0.0 0.0 34.36 2.32


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.