Multiple sequence alignment - TraesCS7B01G458100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G458100 chr7B 100.000 2645 0 0 1 2645 716872076 716874720 0 4885
1 TraesCS7B01G458100 chr7B 98.904 2646 28 1 1 2645 742996151 742993506 0 4724
2 TraesCS7B01G458100 chrUn 98.978 2643 26 1 1 2642 186201715 186204357 0 4730
3 TraesCS7B01G458100 chr1A 98.904 2646 25 3 1 2645 498684525 498687167 0 4723
4 TraesCS7B01G458100 chr5A 98.526 2646 38 1 1 2645 492862433 492859788 0 4669
5 TraesCS7B01G458100 chr2B 98.375 2646 42 1 1 2645 391167714 391165069 0 4647
6 TraesCS7B01G458100 chr2B 98.224 2646 43 3 1 2645 112847905 112845263 0 4623
7 TraesCS7B01G458100 chr4A 98.338 2647 41 3 1 2645 67603672 67601027 0 4641
8 TraesCS7B01G458100 chr3A 98.224 2646 46 1 1 2645 725803458 725800813 0 4625
9 TraesCS7B01G458100 chr4B 98.224 2646 44 3 1 2645 209306366 209303723 0 4623


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G458100 chr7B 716872076 716874720 2644 False 4885 4885 100.000 1 2645 1 chr7B.!!$F1 2644
1 TraesCS7B01G458100 chr7B 742993506 742996151 2645 True 4724 4724 98.904 1 2645 1 chr7B.!!$R1 2644
2 TraesCS7B01G458100 chrUn 186201715 186204357 2642 False 4730 4730 98.978 1 2642 1 chrUn.!!$F1 2641
3 TraesCS7B01G458100 chr1A 498684525 498687167 2642 False 4723 4723 98.904 1 2645 1 chr1A.!!$F1 2644
4 TraesCS7B01G458100 chr5A 492859788 492862433 2645 True 4669 4669 98.526 1 2645 1 chr5A.!!$R1 2644
5 TraesCS7B01G458100 chr2B 391165069 391167714 2645 True 4647 4647 98.375 1 2645 1 chr2B.!!$R2 2644
6 TraesCS7B01G458100 chr2B 112845263 112847905 2642 True 4623 4623 98.224 1 2645 1 chr2B.!!$R1 2644
7 TraesCS7B01G458100 chr4A 67601027 67603672 2645 True 4641 4641 98.338 1 2645 1 chr4A.!!$R1 2644
8 TraesCS7B01G458100 chr3A 725800813 725803458 2645 True 4625 4625 98.224 1 2645 1 chr3A.!!$R1 2644
9 TraesCS7B01G458100 chr4B 209303723 209306366 2643 True 4623 4623 98.224 1 2645 1 chr4B.!!$R1 2644

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
95 96 0.983378 ATTAGAAGTCGGCTGCCCCT 60.983 55.0 14.12 6.39 0.0 4.79 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2073 2076 3.96925 GAAACATCGGCCCCGCTCA 62.969 63.158 0.0 0.0 39.59 4.26 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
27 28 1.073125 TCAATCAAGTGCGGGAAGGAA 59.927 47.619 0.00 0.00 0.00 3.36
95 96 0.983378 ATTAGAAGTCGGCTGCCCCT 60.983 55.000 14.12 6.39 0.00 4.79
291 292 5.023533 TGTAAAGAATGAGGCGCTAGAAT 57.976 39.130 7.64 0.00 0.00 2.40
602 604 3.898529 ACTAATACGAGCCGCATACTTC 58.101 45.455 0.00 0.00 0.00 3.01
1506 1509 5.435686 AACAACTCCATATTCTACTGGCA 57.564 39.130 0.00 0.00 32.30 4.92
2073 2076 0.671781 GGATGATCGGCAAGCGCTAT 60.672 55.000 12.05 0.00 38.60 2.97
2239 2243 1.450312 GATCACGCTGGGTCCTTGG 60.450 63.158 0.00 0.00 0.00 3.61
2290 2294 2.525784 TGCCCATGCAAACCAAAGT 58.474 47.368 0.00 0.00 46.66 2.66
2402 2406 0.326264 GCTCACCTCACTGGACCAAT 59.674 55.000 0.00 0.00 39.71 3.16
2538 2542 4.628074 AGCTCTAAAAACAGCGTTCTACA 58.372 39.130 0.00 0.00 0.00 2.74
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
27 28 0.700564 TGCCTGCCTCTCTCCAAAAT 59.299 50.000 0.00 0.00 0.00 1.82
95 96 0.907486 AGACATAGCCTTGCTGCTGA 59.093 50.000 0.00 0.00 42.77 4.26
489 491 1.686052 CTCTATCCTTCCAAGCGAGCT 59.314 52.381 0.00 0.00 0.00 4.09
602 604 9.265901 CTTTCCTCCAATATGTCACTAGTATTG 57.734 37.037 7.93 7.93 36.21 1.90
1506 1509 5.268131 TGGATAGTAGATCAGAGAGGCAT 57.732 43.478 0.00 0.00 0.00 4.40
1760 1763 5.506815 CGATAATCTAGCGTGAACTAACCCA 60.507 44.000 0.00 0.00 32.13 4.51
2073 2076 3.969250 GAAACATCGGCCCCGCTCA 62.969 63.158 0.00 0.00 39.59 4.26
2290 2294 9.982651 GGATCTGTAATAGTTGTATCTGCTTTA 57.017 33.333 0.00 0.00 0.00 1.85
2512 2516 3.386768 ACGCTGTTTTTAGAGCTCTCA 57.613 42.857 22.17 6.49 32.70 3.27
2538 2542 9.533831 AAAGTATACAAAAATCACATTCTCCCT 57.466 29.630 5.50 0.00 0.00 4.20


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.