Multiple sequence alignment - TraesCS7B01G457900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G457900 chr7B 100.000 2573 0 0 1 2573 716843187 716840615 0 4752
1 TraesCS7B01G457900 chr7B 99.029 2574 24 1 1 2573 716883428 716880855 0 4614
2 TraesCS7B01G457900 chr7B 98.873 2573 28 1 1 2573 742984797 742987368 0 4590
3 TraesCS7B01G457900 chr5A 99.145 2574 21 1 1 2573 19253496 19250923 0 4630
4 TraesCS7B01G457900 chr6D 98.717 2573 24 3 1 2573 124512887 124515450 0 4560
5 TraesCS7B01G457900 chr7D 98.562 2573 28 4 1 2573 203495362 203497925 0 4538
6 TraesCS7B01G457900 chr7D 98.407 2573 32 3 1 2573 381978399 381975836 0 4516
7 TraesCS7B01G457900 chr4B 98.018 2573 50 1 1 2573 209295188 209297759 0 4468


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G457900 chr7B 716840615 716843187 2572 True 4752 4752 100.000 1 2573 1 chr7B.!!$R1 2572
1 TraesCS7B01G457900 chr7B 716880855 716883428 2573 True 4614 4614 99.029 1 2573 1 chr7B.!!$R2 2572
2 TraesCS7B01G457900 chr7B 742984797 742987368 2571 False 4590 4590 98.873 1 2573 1 chr7B.!!$F1 2572
3 TraesCS7B01G457900 chr5A 19250923 19253496 2573 True 4630 4630 99.145 1 2573 1 chr5A.!!$R1 2572
4 TraesCS7B01G457900 chr6D 124512887 124515450 2563 False 4560 4560 98.717 1 2573 1 chr6D.!!$F1 2572
5 TraesCS7B01G457900 chr7D 203495362 203497925 2563 False 4538 4538 98.562 1 2573 1 chr7D.!!$F1 2572
6 TraesCS7B01G457900 chr7D 381975836 381978399 2563 True 4516 4516 98.407 1 2573 1 chr7D.!!$R1 2572
7 TraesCS7B01G457900 chr4B 209295188 209297759 2571 False 4468 4468 98.018 1 2573 1 chr4B.!!$F1 2572

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
503 504 4.842574 TGTCAATATCCAACAGCTTAGCA 58.157 39.13 7.07 0.0 0.0 3.49 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2245 2246 3.424039 GCGGCCTTCGTTCTTAAGTTAAC 60.424 47.826 0.0 0.0 41.72 2.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
89 90 4.911514 TTGTAGAAACCTTGCTTGTTCC 57.088 40.909 0.00 0.00 0.00 3.62
265 266 5.828328 GGCAACCCTTTAGATATTGCTTAGT 59.172 40.000 7.15 0.00 44.03 2.24
272 273 8.211629 CCCTTTAGATATTGCTTAGTGTTAGGT 58.788 37.037 0.00 0.00 0.00 3.08
503 504 4.842574 TGTCAATATCCAACAGCTTAGCA 58.157 39.130 7.07 0.00 0.00 3.49
2061 2062 3.775654 CGCCTCCTTTCCTCCGCT 61.776 66.667 0.00 0.00 0.00 5.52
2245 2246 8.557864 CAAATCTAATAGTTCCATCTGCTCTTG 58.442 37.037 0.00 0.00 0.00 3.02
2457 2458 3.015145 GCCTAGGAGGGCCAACCA 61.015 66.667 14.75 7.01 45.92 3.67
2568 2570 7.201920 AGAGATTCCCCATCTATATCCAATCA 58.798 38.462 0.00 0.00 42.92 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
89 90 7.596749 AGATCAACTTAATTCAACTGTACGG 57.403 36.000 0.00 0.00 0.00 4.02
503 504 6.793505 AAGGAGTTCTGGAACGATTACTAT 57.206 37.500 7.67 0.00 45.50 2.12
1231 1232 4.201851 GCGTGAGTTATACCGAGTACTCAA 60.202 45.833 22.37 7.77 45.94 3.02
2149 2150 6.440328 ACAATCCATTTATGTAAAGCAAGGGT 59.560 34.615 0.00 0.00 0.00 4.34
2245 2246 3.424039 GCGGCCTTCGTTCTTAAGTTAAC 60.424 47.826 0.00 0.00 41.72 2.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.