Multiple sequence alignment - TraesCS7B01G457800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G457800 chr7B 100.000 2440 0 0 1 2440 716836937 716839376 0 4506
1 TraesCS7B01G457800 chr7B 98.825 1532 15 3 911 2440 742990137 742988607 0 2726
2 TraesCS7B01G457800 chr7B 98.629 1532 15 4 911 2440 716878089 716879616 0 2708
3 TraesCS7B01G457800 chr7B 99.671 912 3 0 1 912 716877148 716878059 0 1668
4 TraesCS7B01G457800 chr5A 98.763 1536 11 4 911 2440 19248151 19249684 0 2724
5 TraesCS7B01G457800 chr5A 99.781 912 2 0 1 912 19247210 19248121 0 1674
6 TraesCS7B01G457800 chr7A 98.760 1532 15 3 911 2440 60280005 60278476 0 2721
7 TraesCS7B01G457800 chr7A 98.758 1530 15 2 911 2440 120840468 120841993 0 2717
8 TraesCS7B01G457800 chr7D 98.694 1531 17 2 911 2440 381924693 381923165 0 2713
9 TraesCS7B01G457800 chr7D 99.452 912 5 0 1 912 381925634 381924723 0 1657
10 TraesCS7B01G457800 chr7D 99.342 912 6 0 1 912 203501632 203500721 0 1652
11 TraesCS7B01G457800 chr7D 99.342 912 6 0 1 912 382051712 382050801 0 1652
12 TraesCS7B01G457800 chr7D 99.342 912 3 1 1 912 381972137 381973045 0 1648
13 TraesCS7B01G457800 chrUn 98.629 1532 19 2 911 2440 186207729 186209260 0 2712
14 TraesCS7B01G457800 chrUn 99.452 912 5 0 1 912 186206788 186207699 0 1657
15 TraesCS7B01G457800 chr6D 98.694 1531 15 3 911 2440 124518214 124516688 0 2712
16 TraesCS7B01G457800 chr1A 98.628 1531 15 3 911 2440 498690535 498692060 0 2706
17 TraesCS7B01G457800 chr1A 99.342 912 6 0 1 912 498689594 498690505 0 1652
18 TraesCS7B01G457800 chr3B 99.232 912 7 0 1 912 768282266 768283177 0 1646


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G457800 chr7B 716836937 716839376 2439 False 4506.0 4506 100.0000 1 2440 1 chr7B.!!$F1 2439
1 TraesCS7B01G457800 chr7B 742988607 742990137 1530 True 2726.0 2726 98.8250 911 2440 1 chr7B.!!$R1 1529
2 TraesCS7B01G457800 chr7B 716877148 716879616 2468 False 2188.0 2708 99.1500 1 2440 2 chr7B.!!$F2 2439
3 TraesCS7B01G457800 chr5A 19247210 19249684 2474 False 2199.0 2724 99.2720 1 2440 2 chr5A.!!$F1 2439
4 TraesCS7B01G457800 chr7A 60278476 60280005 1529 True 2721.0 2721 98.7600 911 2440 1 chr7A.!!$R1 1529
5 TraesCS7B01G457800 chr7A 120840468 120841993 1525 False 2717.0 2717 98.7580 911 2440 1 chr7A.!!$F1 1529
6 TraesCS7B01G457800 chr7D 381923165 381925634 2469 True 2185.0 2713 99.0730 1 2440 2 chr7D.!!$R3 2439
7 TraesCS7B01G457800 chr7D 203500721 203501632 911 True 1652.0 1652 99.3420 1 912 1 chr7D.!!$R1 911
8 TraesCS7B01G457800 chr7D 382050801 382051712 911 True 1652.0 1652 99.3420 1 912 1 chr7D.!!$R2 911
9 TraesCS7B01G457800 chr7D 381972137 381973045 908 False 1648.0 1648 99.3420 1 912 1 chr7D.!!$F1 911
10 TraesCS7B01G457800 chrUn 186206788 186209260 2472 False 2184.5 2712 99.0405 1 2440 2 chrUn.!!$F1 2439
11 TraesCS7B01G457800 chr6D 124516688 124518214 1526 True 2712.0 2712 98.6940 911 2440 1 chr6D.!!$R1 1529
12 TraesCS7B01G457800 chr1A 498689594 498692060 2466 False 2179.0 2706 98.9850 1 2440 2 chr1A.!!$F1 2439
13 TraesCS7B01G457800 chr3B 768282266 768283177 911 False 1646.0 1646 99.2320 1 912 1 chr3B.!!$F1 911

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
342 343 1.730501 ATGGCGAATGCATCTATCGG 58.269 50.0 18.19 3.7 45.35 4.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2157 2237 0.036765 CGACCCAATGACCTTTCCGA 60.037 55.0 0.0 0.0 0.0 4.55 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
26 27 3.496884 GTGTTGCAACTGATTCGGTAAGA 59.503 43.478 28.61 2.21 0.00 2.10
342 343 1.730501 ATGGCGAATGCATCTATCGG 58.269 50.000 18.19 3.70 45.35 4.18
1090 1153 1.383248 AAGGCTGCTATCCCCTCGT 60.383 57.895 0.00 0.00 0.00 4.18
1104 1167 2.224793 CCCCTCGTCCTTCTTCCTTTTT 60.225 50.000 0.00 0.00 0.00 1.94
1376 1442 1.008538 GGTGCTTTCCTGTGTTGCG 60.009 57.895 0.00 0.00 0.00 4.85
1511 1577 1.855599 AGGGGGAGCTGCATCTTATTT 59.144 47.619 7.79 0.00 0.00 1.40
2106 2186 0.984995 GGTACTTCTGGAGGGCAAGT 59.015 55.000 0.00 0.00 34.68 3.16
2157 2237 2.681344 GGGCGACGAATACTTCCAATTT 59.319 45.455 0.00 0.00 0.00 1.82
2432 2512 4.632251 GGAACAAAGCTAAGAAGTAGGCTC 59.368 45.833 0.00 0.00 33.63 4.70
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1090 1153 7.846066 TGTTTTTCATCAAAAAGGAAGAAGGA 58.154 30.769 0.00 0.00 41.23 3.36
1104 1167 7.200778 TGAGATGTCGATTTGTTTTTCATCA 57.799 32.000 8.87 0.00 34.55 3.07
1169 1234 1.797025 AAAGGAAAGGCTCGACGAAG 58.203 50.000 0.00 0.00 0.00 3.79
1511 1577 1.611977 TCCTGAAGTTCTCGCGAAGAA 59.388 47.619 11.33 13.22 41.81 2.52
1737 1806 2.380084 AAGAGCGGTGCGAATTAGAA 57.620 45.000 0.00 0.00 0.00 2.10
1750 1819 5.292834 TGATGCAATTTAGAGAGAAAGAGCG 59.707 40.000 0.00 0.00 0.00 5.03
2157 2237 0.036765 CGACCCAATGACCTTTCCGA 60.037 55.000 0.00 0.00 0.00 4.55


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.