Multiple sequence alignment - TraesCS7B01G457600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G457600 chr7B 100.000 2717 0 0 1 2717 716835099 716837815 0 5018
1 TraesCS7B01G457600 chr7B 98.749 2717 30 1 1 2717 716875314 716878026 0 4826
2 TraesCS7B01G457600 chr5A 98.898 2722 21 3 1 2717 19245371 19248088 0 4852
3 TraesCS7B01G457600 chr7D 98.751 2723 24 5 1 2717 381970294 381973012 0 4831
4 TraesCS7B01G457600 chr7D 98.641 2722 26 4 1 2717 382053549 382050834 0 4811
5 TraesCS7B01G457600 chr7D 98.494 2722 30 4 1 2717 203503469 203500754 0 4789
6 TraesCS7B01G457600 chr7A 98.565 2717 34 2 1 2717 60282779 60280068 0 4796
7 TraesCS7B01G457600 chr1A 98.565 2717 34 2 1 2717 498687761 498690472 0 4796


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G457600 chr7B 716835099 716837815 2716 False 5018 5018 100.000 1 2717 1 chr7B.!!$F1 2716
1 TraesCS7B01G457600 chr7B 716875314 716878026 2712 False 4826 4826 98.749 1 2717 1 chr7B.!!$F2 2716
2 TraesCS7B01G457600 chr5A 19245371 19248088 2717 False 4852 4852 98.898 1 2717 1 chr5A.!!$F1 2716
3 TraesCS7B01G457600 chr7D 381970294 381973012 2718 False 4831 4831 98.751 1 2717 1 chr7D.!!$F1 2716
4 TraesCS7B01G457600 chr7D 382050834 382053549 2715 True 4811 4811 98.641 1 2717 1 chr7D.!!$R2 2716
5 TraesCS7B01G457600 chr7D 203500754 203503469 2715 True 4789 4789 98.494 1 2717 1 chr7D.!!$R1 2716
6 TraesCS7B01G457600 chr7A 60280068 60282779 2711 True 4796 4796 98.565 1 2717 1 chr7A.!!$R1 2716
7 TraesCS7B01G457600 chr1A 498687761 498690472 2711 False 4796 4796 98.565 1 2717 1 chr1A.!!$F1 2716

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
983 984 1.123928 CCCCGAATAAGTCAGGCTCT 58.876 55.0 0.0 0.0 0.0 4.09 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1791 1802 3.130516 GGTCGAGTCTGATACATCAACCA 59.869 47.826 0.0 0.0 36.18 3.67 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
106 107 6.398918 CCGTATCAATCCTTTAATCGGAGAT 58.601 40.000 0.00 2.38 45.12 2.75
107 108 6.311445 CCGTATCAATCCTTTAATCGGAGATG 59.689 42.308 0.00 3.19 45.12 2.90
967 968 1.950748 TAGGCTCCACTCTCTCCCCC 61.951 65.000 0.00 0.00 0.00 5.40
983 984 1.123928 CCCCGAATAAGTCAGGCTCT 58.876 55.000 0.00 0.00 0.00 4.09
1050 1051 1.270094 CCAACGTTCTGCCAGACACTA 60.270 52.381 0.00 0.00 0.00 2.74
1080 1081 5.811100 GGGTAAGCTCTGTAAATGTGTAGAC 59.189 44.000 0.00 0.00 0.00 2.59
1096 1102 0.396811 AGACCCAAGTGTGGTGTAGC 59.603 55.000 0.00 0.00 44.30 3.58
1103 1109 2.299013 CAAGTGTGGTGTAGCAGTAGGA 59.701 50.000 0.00 0.00 0.00 2.94
1197 1203 1.712081 CAGAGCCGTTTCATGAGCG 59.288 57.895 12.83 12.83 0.00 5.03
1199 1205 2.436646 AGCCGTTTCATGAGCGGG 60.437 61.111 29.40 18.41 45.02 6.13
1200 1206 3.508840 GCCGTTTCATGAGCGGGG 61.509 66.667 29.40 17.01 45.02 5.73
1302 1313 9.598517 GATGGATGGATCTATCTTTCTATTCAC 57.401 37.037 17.50 0.00 40.41 3.18
1633 1644 2.253403 GAAAGGAATCGAGGCCCGGT 62.253 60.000 12.77 3.78 39.14 5.28
1791 1802 4.395625 TCGTACAAGGATATGGAGTCGAT 58.604 43.478 0.00 0.00 0.00 3.59
1864 1875 3.496884 GTGTTGCAACTGATTCGGTAAGA 59.503 43.478 28.61 2.21 0.00 2.10
2180 2191 1.730501 ATGGCGAATGCATCTATCGG 58.269 50.000 18.19 3.70 45.35 4.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
106 107 3.015327 GTCCTTCCTAACGCTAGTCTCA 58.985 50.000 0.00 0.0 0.00 3.27
107 108 3.015327 TGTCCTTCCTAACGCTAGTCTC 58.985 50.000 0.00 0.0 0.00 3.36
226 227 2.582052 ACAAAGGCGAAGACAATTCCA 58.418 42.857 0.00 0.0 39.87 3.53
967 968 3.799420 GCTAACAGAGCCTGACTTATTCG 59.201 47.826 8.91 0.0 46.41 3.34
1050 1051 2.921834 TACAGAGCTTACCCCTGTCT 57.078 50.000 8.18 0.0 41.01 3.41
1096 1102 1.763545 GGGGCCTAGAAGTTCCTACTG 59.236 57.143 0.84 0.0 34.01 2.74
1103 1109 1.272554 CGGGAAGGGGCCTAGAAGTT 61.273 60.000 0.84 0.0 0.00 2.66
1302 1313 3.385433 TGGGGCTGATTGCAAAAGATATG 59.615 43.478 14.83 0.0 45.15 1.78
1559 1570 2.230130 TCTCATTTGGGGCGGAAAAT 57.770 45.000 0.00 0.0 0.00 1.82
1633 1644 4.047059 GGAACGACACGAGCCGGA 62.047 66.667 5.05 0.0 0.00 5.14
1791 1802 3.130516 GGTCGAGTCTGATACATCAACCA 59.869 47.826 0.00 0.0 36.18 3.67


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.