Multiple sequence alignment - TraesCS7B01G457500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G457500 chr7B 100.000 2231 0 0 1 2231 716836897 716834667 0 4120
1 TraesCS7B01G457500 chr7B 98.476 2231 30 2 1 2231 742991118 742993344 0 3928
2 TraesCS7B01G457500 chr7B 98.431 2231 31 1 1 2231 716877108 716874882 0 3923
3 TraesCS7B01G457500 chr7A 98.431 2231 30 2 1 2231 60280986 60283211 0 3921
4 TraesCS7B01G457500 chrUn 98.386 2231 32 1 1 2231 186206748 186204522 0 3917
5 TraesCS7B01G457500 chr1A 98.297 2231 33 2 1 2231 498689554 498687329 0 3904
6 TraesCS7B01G457500 chr7D 98.588 2196 24 3 1 2190 381972097 381969903 0 3877
7 TraesCS7B01G457500 chr2B 97.983 2231 40 2 1 2231 391162682 391164907 0 3866
8 TraesCS7B01G457500 chr5A 97.807 2234 38 3 1 2229 238821135 238818908 0 3843


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G457500 chr7B 716834667 716836897 2230 True 4120 4120 100.000 1 2231 1 chr7B.!!$R1 2230
1 TraesCS7B01G457500 chr7B 742991118 742993344 2226 False 3928 3928 98.476 1 2231 1 chr7B.!!$F1 2230
2 TraesCS7B01G457500 chr7B 716874882 716877108 2226 True 3923 3923 98.431 1 2231 1 chr7B.!!$R2 2230
3 TraesCS7B01G457500 chr7A 60280986 60283211 2225 False 3921 3921 98.431 1 2231 1 chr7A.!!$F1 2230
4 TraesCS7B01G457500 chrUn 186204522 186206748 2226 True 3917 3917 98.386 1 2231 1 chrUn.!!$R1 2230
5 TraesCS7B01G457500 chr1A 498687329 498689554 2225 True 3904 3904 98.297 1 2231 1 chr1A.!!$R1 2230
6 TraesCS7B01G457500 chr7D 381969903 381972097 2194 True 3877 3877 98.588 1 2190 1 chr7D.!!$R1 2189
7 TraesCS7B01G457500 chr2B 391162682 391164907 2225 False 3866 3866 97.983 1 2231 1 chr2B.!!$F1 2230
8 TraesCS7B01G457500 chr5A 238818908 238821135 2227 True 3843 3843 97.807 1 2229 1 chr5A.!!$R1 2228

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
695 698 1.272554 CGGGAAGGGGCCTAGAAGTT 61.273 60.0 0.84 0.0 0.0 2.66 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1834 1843 1.071471 GGATGCACCGGTATCTGGG 59.929 63.158 6.87 0.0 36.49 4.45 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
165 166 4.047059 GGAACGACACGAGCCGGA 62.047 66.667 5.05 0.0 0.00 5.14
239 240 2.230130 TCTCATTTGGGGCGGAAAAT 57.770 45.000 0.00 0.0 0.00 1.82
496 497 3.385433 TGGGGCTGATTGCAAAAGATATG 59.615 43.478 14.83 0.0 45.15 1.78
695 698 1.272554 CGGGAAGGGGCCTAGAAGTT 61.273 60.000 0.84 0.0 0.00 2.66
702 705 1.763545 GGGGCCTAGAAGTTCCTACTG 59.236 57.143 0.84 0.0 34.01 2.74
748 756 2.921834 TACAGAGCTTACCCCTGTCT 57.078 50.000 8.18 0.0 41.01 3.41
831 839 3.799420 GCTAACAGAGCCTGACTTATTCG 59.201 47.826 8.91 0.0 46.41 3.34
1106 1114 1.061546 AAACGCTCCTAACCCCTTCA 58.938 50.000 0.00 0.0 0.00 3.02
1691 1700 3.015327 TGTCCTTCCTAACGCTAGTCTC 58.985 50.000 0.00 0.0 0.00 3.36
1692 1701 3.015327 GTCCTTCCTAACGCTAGTCTCA 58.985 50.000 0.00 0.0 0.00 3.27
1834 1843 0.460284 CTACTGGGTCCATCACGTGC 60.460 60.000 11.67 0.0 0.00 5.34
1898 1907 0.838554 TGGATCAAAGTCCCCGGACA 60.839 55.000 16.08 0.0 46.76 4.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
7 8 4.395625 TCGTACAAGGATATGGAGTCGAT 58.604 43.478 0.00 0.00 0.00 3.59
165 166 2.253403 GAAAGGAATCGAGGCCCGGT 62.253 60.000 12.77 3.78 39.14 5.28
496 497 9.598517 GATGGATGGATCTATCTTTCTATTCAC 57.401 37.037 17.50 0.00 40.41 3.18
695 698 2.299013 CAAGTGTGGTGTAGCAGTAGGA 59.701 50.000 0.00 0.00 0.00 2.94
702 705 0.396811 AGACCCAAGTGTGGTGTAGC 59.603 55.000 0.00 0.00 44.30 3.58
718 726 5.811100 GGGTAAGCTCTGTAAATGTGTAGAC 59.189 44.000 0.00 0.00 0.00 2.59
748 756 1.270094 CCAACGTTCTGCCAGACACTA 60.270 52.381 0.00 0.00 0.00 2.74
815 823 1.123928 CCCCGAATAAGTCAGGCTCT 58.876 55.000 0.00 0.00 0.00 4.09
831 839 1.950748 TAGGCTCCACTCTCTCCCCC 61.951 65.000 0.00 0.00 0.00 5.40
1106 1114 4.733165 TCACTTACTATACACGGCCCTAT 58.267 43.478 0.00 0.00 0.00 2.57
1691 1700 6.311445 CCGTATCAATCCTTTAATCGGAGATG 59.689 42.308 0.00 3.19 45.12 2.90
1692 1701 6.398918 CCGTATCAATCCTTTAATCGGAGAT 58.601 40.000 0.00 2.38 45.12 2.75
1834 1843 1.071471 GGATGCACCGGTATCTGGG 59.929 63.158 6.87 0.00 36.49 4.45
1898 1907 9.469807 CTAGTTCTTTCTATAATGAGCATTCGT 57.530 33.333 0.00 0.00 32.50 3.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.