Multiple sequence alignment - TraesCS7B01G457400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G457400 chr7B 100.000 2378 0 0 1 2378 716830618 716832995 0 4392
1 TraesCS7B01G457400 chr7B 98.869 973 11 0 1406 2378 716872239 716873211 0 1736
2 TraesCS7B01G457400 chr7B 98.869 973 11 0 1406 2378 742995988 742995016 0 1736
3 TraesCS7B01G457400 chr1A 99.004 1406 14 0 1 1406 238154728 238153323 0 2519
4 TraesCS7B01G457400 chr1A 98.862 1406 16 0 1 1406 238109343 238107938 0 2508
5 TraesCS7B01G457400 chr1A 98.664 973 11 1 1406 2378 498684687 498685657 0 1724
6 TraesCS7B01G457400 chr3A 98.862 1406 16 0 1 1406 191855951 191857356 0 2508
7 TraesCS7B01G457400 chr7A 98.720 1406 18 0 1 1406 60328608 60327203 0 2497
8 TraesCS7B01G457400 chr7A 99.075 973 9 0 1406 2378 60285838 60284866 0 1748
9 TraesCS7B01G457400 chr5A 98.720 1406 18 0 1 1406 16577518 16576113 0 2497
10 TraesCS7B01G457400 chr5A 98.561 973 14 0 1406 2378 492862270 492861298 0 1720
11 TraesCS7B01G457400 chr7D 98.649 1406 19 0 1 1406 579015980 579017385 0 2492
12 TraesCS7B01G457400 chr6B 98.649 1406 18 1 1 1406 596656904 596655500 0 2490
13 TraesCS7B01G457400 chr6B 98.578 1406 18 2 1 1406 394497045 394498448 0 2484
14 TraesCS7B01G457400 chrUn 98.649 1406 16 1 1 1406 237257428 237256026 0 2488
15 TraesCS7B01G457400 chrUn 98.972 973 10 0 1406 2378 186201878 186202850 0 1742
16 TraesCS7B01G457400 chr2B 98.767 973 12 0 1406 2378 391167551 391166579 0 1731
17 TraesCS7B01G457400 chr2B 98.664 973 13 0 1406 2378 112847742 112846770 0 1725
18 TraesCS7B01G457400 chr5B 98.356 973 16 0 1406 2378 392081763 392080791 0 1709


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G457400 chr7B 716830618 716832995 2377 False 4392 4392 100.000 1 2378 1 chr7B.!!$F1 2377
1 TraesCS7B01G457400 chr7B 716872239 716873211 972 False 1736 1736 98.869 1406 2378 1 chr7B.!!$F2 972
2 TraesCS7B01G457400 chr7B 742995016 742995988 972 True 1736 1736 98.869 1406 2378 1 chr7B.!!$R1 972
3 TraesCS7B01G457400 chr1A 238153323 238154728 1405 True 2519 2519 99.004 1 1406 1 chr1A.!!$R2 1405
4 TraesCS7B01G457400 chr1A 238107938 238109343 1405 True 2508 2508 98.862 1 1406 1 chr1A.!!$R1 1405
5 TraesCS7B01G457400 chr1A 498684687 498685657 970 False 1724 1724 98.664 1406 2378 1 chr1A.!!$F1 972
6 TraesCS7B01G457400 chr3A 191855951 191857356 1405 False 2508 2508 98.862 1 1406 1 chr3A.!!$F1 1405
7 TraesCS7B01G457400 chr7A 60327203 60328608 1405 True 2497 2497 98.720 1 1406 1 chr7A.!!$R2 1405
8 TraesCS7B01G457400 chr7A 60284866 60285838 972 True 1748 1748 99.075 1406 2378 1 chr7A.!!$R1 972
9 TraesCS7B01G457400 chr5A 16576113 16577518 1405 True 2497 2497 98.720 1 1406 1 chr5A.!!$R1 1405
10 TraesCS7B01G457400 chr5A 492861298 492862270 972 True 1720 1720 98.561 1406 2378 1 chr5A.!!$R2 972
11 TraesCS7B01G457400 chr7D 579015980 579017385 1405 False 2492 2492 98.649 1 1406 1 chr7D.!!$F1 1405
12 TraesCS7B01G457400 chr6B 596655500 596656904 1404 True 2490 2490 98.649 1 1406 1 chr6B.!!$R1 1405
13 TraesCS7B01G457400 chr6B 394497045 394498448 1403 False 2484 2484 98.578 1 1406 1 chr6B.!!$F1 1405
14 TraesCS7B01G457400 chrUn 237256026 237257428 1402 True 2488 2488 98.649 1 1406 1 chrUn.!!$R1 1405
15 TraesCS7B01G457400 chrUn 186201878 186202850 972 False 1742 1742 98.972 1406 2378 1 chrUn.!!$F1 972
16 TraesCS7B01G457400 chr2B 391166579 391167551 972 True 1731 1731 98.767 1406 2378 1 chr2B.!!$R2 972
17 TraesCS7B01G457400 chr2B 112846770 112847742 972 True 1725 1725 98.664 1406 2378 1 chr2B.!!$R1 972
18 TraesCS7B01G457400 chr5B 392080791 392081763 972 True 1709 1709 98.356 1406 2378 1 chr5B.!!$R1 972

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
603 604 1.963515 GAAGTGGGCTTTGGTGATGTT 59.036 47.619 0.0 0.0 34.61 2.71 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1900 1902 1.065199 CAGCCAGCAGTTCTTATGGGA 60.065 52.381 0.0 0.0 33.23 4.37 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
72 73 5.360591 AGAAGATTGTATCATGGGTTCGAC 58.639 41.667 0.00 0.0 0.00 4.20
523 524 2.567169 TGGTTCGAATCCACATCTGAGT 59.433 45.455 5.84 0.0 0.00 3.41
603 604 1.963515 GAAGTGGGCTTTGGTGATGTT 59.036 47.619 0.00 0.0 34.61 2.71
611 612 4.388485 GGCTTTGGTGATGTTGGAATTTT 58.612 39.130 0.00 0.0 0.00 1.82
1045 1047 7.824289 TGATTCGTCATGGTAGAGAAGAAAAAT 59.176 33.333 0.00 0.0 36.22 1.82
1178 1180 3.821841 CAAAAGTACGGTTGAGCAATCC 58.178 45.455 5.85 0.0 0.00 3.01
1255 1257 7.069877 TCTATAGTCTTAGTCAGAGGAGGTC 57.930 44.000 0.00 0.0 29.34 3.85
1580 1582 2.289547 GACACCGCTTTGCTACTTTTCA 59.710 45.455 0.00 0.0 0.00 2.69
1756 1758 0.465705 CTTGGAAGGATAGAGCGCCA 59.534 55.000 2.29 0.0 0.00 5.69
1799 1801 5.653769 TGAAGGGAAGGCTATGAAAAGAATG 59.346 40.000 0.00 0.0 0.00 2.67
1900 1902 9.900112 ATTATTGGAATACTAGAGGGAGTTACT 57.100 33.333 0.00 0.0 0.00 2.24
1926 1928 1.897560 AGAACTGCTGGCTGTAAACC 58.102 50.000 5.60 0.0 0.00 3.27
1957 1959 3.009143 TCTGCTCCTCCTAAAACCCTTTC 59.991 47.826 0.00 0.0 0.00 2.62
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
918 920 2.695147 GCACCCCTTTTCCATTCATAGG 59.305 50.000 0.00 0.0 0.00 2.57
1178 1180 7.878036 TGGAATGTGAGCAAATATATCATGTG 58.122 34.615 0.00 0.0 0.00 3.21
1255 1257 1.002366 CCTGGCGAATCTTTCACTCG 58.998 55.000 0.00 0.0 35.70 4.18
1580 1582 5.196695 ACAAGCAACTTCTCTTCCTCTTTT 58.803 37.500 0.00 0.0 0.00 2.27
1756 1758 5.359009 CCTTCAATATGCCATCTTGTCTTGT 59.641 40.000 3.14 0.0 0.00 3.16
1799 1801 2.507324 GGCGTTCGAGAGACCAGC 60.507 66.667 0.00 0.0 41.84 4.85
1900 1902 1.065199 CAGCCAGCAGTTCTTATGGGA 60.065 52.381 0.00 0.0 33.23 4.37
1926 1928 1.153667 GAGGAGCAGAGCAAGTCGG 60.154 63.158 0.00 0.0 0.00 4.79


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.