Multiple sequence alignment - TraesCS7B01G457100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G457100 chr7B 100.000 3162 0 0 1 3162 716798045 716794884 0 5840
1 TraesCS7B01G457100 chr7B 98.387 3162 39 4 1 3162 742935285 742938434 0 5546
2 TraesCS7B01G457100 chr7B 96.634 3179 88 8 1 3162 47217231 47220407 0 5260
3 TraesCS7B01G457100 chr7B 96.187 3173 88 8 1 3162 139621809 139618659 0 5158
4 TraesCS7B01G457100 chr6B 98.893 3162 29 2 1 3162 128892184 128889029 0 5640
5 TraesCS7B01G457100 chr5B 98.830 3162 34 3 1 3162 713115167 713112009 0 5631
6 TraesCS7B01G457100 chr5B 98.577 3162 43 2 1 3162 713093560 713096719 0 5589
7 TraesCS7B01G457100 chr5B 98.371 2271 30 2 1 2271 127821200 127818937 0 3982
8 TraesCS7B01G457100 chr1B 98.577 3162 43 1 1 3162 583548104 583551263 0 5589
9 TraesCS7B01G457100 chr1B 97.131 3172 70 8 1 3162 49787126 49783966 0 5334
10 TraesCS7B01G457100 chr1B 97.012 3179 72 9 1 3162 49815629 49818801 0 5323
11 TraesCS7B01G457100 chr7A 98.491 2253 28 5 913 3162 60097493 60095244 0 3967


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G457100 chr7B 716794884 716798045 3161 True 5840 5840 100.000 1 3162 1 chr7B.!!$R2 3161
1 TraesCS7B01G457100 chr7B 742935285 742938434 3149 False 5546 5546 98.387 1 3162 1 chr7B.!!$F2 3161
2 TraesCS7B01G457100 chr7B 47217231 47220407 3176 False 5260 5260 96.634 1 3162 1 chr7B.!!$F1 3161
3 TraesCS7B01G457100 chr7B 139618659 139621809 3150 True 5158 5158 96.187 1 3162 1 chr7B.!!$R1 3161
4 TraesCS7B01G457100 chr6B 128889029 128892184 3155 True 5640 5640 98.893 1 3162 1 chr6B.!!$R1 3161
5 TraesCS7B01G457100 chr5B 713112009 713115167 3158 True 5631 5631 98.830 1 3162 1 chr5B.!!$R2 3161
6 TraesCS7B01G457100 chr5B 713093560 713096719 3159 False 5589 5589 98.577 1 3162 1 chr5B.!!$F1 3161
7 TraesCS7B01G457100 chr5B 127818937 127821200 2263 True 3982 3982 98.371 1 2271 1 chr5B.!!$R1 2270
8 TraesCS7B01G457100 chr1B 583548104 583551263 3159 False 5589 5589 98.577 1 3162 1 chr1B.!!$F2 3161
9 TraesCS7B01G457100 chr1B 49783966 49787126 3160 True 5334 5334 97.131 1 3162 1 chr1B.!!$R1 3161
10 TraesCS7B01G457100 chr1B 49815629 49818801 3172 False 5323 5323 97.012 1 3162 1 chr1B.!!$F1 3161
11 TraesCS7B01G457100 chr7A 60095244 60097493 2249 True 3967 3967 98.491 913 3162 1 chr7A.!!$R1 2249

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
326 332 3.956744 AGTTCAGGATTGGTAGGAAAGC 58.043 45.455 0.0 0.0 0.0 3.51 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2212 2254 0.250727 CCCGGAACCATGTTCAGTGT 60.251 55.0 0.73 0.0 0.0 3.55 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
326 332 3.956744 AGTTCAGGATTGGTAGGAAAGC 58.043 45.455 0.00 0.00 0.00 3.51
1018 1030 6.406400 CCTGGAGATGAGATTTCTTTCTACGT 60.406 42.308 0.00 0.00 0.00 3.57
1499 1536 3.437741 ACTGTCGTTTTGGTCGTTTTTCT 59.562 39.130 0.00 0.00 0.00 2.52
2209 2251 1.581447 GGCTACAGCTGCGCTTTTT 59.419 52.632 22.88 2.61 36.40 1.94
2212 2254 1.334960 GCTACAGCTGCGCTTTTTCAA 60.335 47.619 15.27 0.00 36.40 2.69
2279 2321 8.475639 GTTTGGAGAGGTGTAGATTGTAGATTA 58.524 37.037 0.00 0.00 0.00 1.75
2699 2742 4.319911 CCGAAAGAACAAGCAACGGATTTA 60.320 41.667 0.00 0.00 41.09 1.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
709 715 0.596600 GACTTCGCGGAACACTCACA 60.597 55.000 6.13 0.00 0.00 3.58
2050 2092 3.450904 AGCTACACCTAATTCCAGACCA 58.549 45.455 0.00 0.00 0.00 4.02
2209 2251 2.217750 CGGAACCATGTTCAGTGTTGA 58.782 47.619 9.01 0.00 0.00 3.18
2212 2254 0.250727 CCCGGAACCATGTTCAGTGT 60.251 55.000 0.73 0.00 0.00 3.55
2279 2321 0.832135 TTCCTGGTCTTCTCGGCTGT 60.832 55.000 0.00 0.00 0.00 4.40
2615 2658 6.092259 GTCCTTGCATTAGTATGAGTTCGTTT 59.908 38.462 0.00 0.00 33.37 3.60
2699 2742 0.253044 TTTAGCAAGGGATGAGCGCT 59.747 50.000 11.27 11.27 42.29 5.92
2839 2883 0.389391 CAGACGTGGAGTGGTGAAGT 59.611 55.000 0.00 0.00 0.00 3.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.