Multiple sequence alignment - TraesCS7B01G457000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G457000 chr7B 100.000 2519 0 0 1 2519 716795815 716793297 0 4652
1 TraesCS7B01G457000 chr7B 98.888 2519 27 1 1 2519 698126910 698124393 0 4495
2 TraesCS7B01G457000 chr7B 98.412 2519 36 2 1 2519 742937505 742940019 0 4427
3 TraesCS7B01G457000 chr7B 95.723 2525 101 3 1 2519 139619594 139617071 0 4058
4 TraesCS7B01G457000 chrUn 98.849 2519 28 1 1 2519 233525244 233522727 0 4490
5 TraesCS7B01G457000 chrUn 98.693 2524 27 2 1 2519 257944136 257946658 0 4473
6 TraesCS7B01G457000 chr7A 98.769 2519 31 0 1 2519 60096175 60093657 0 4481
7 TraesCS7B01G457000 chr1D 98.613 2524 30 1 1 2519 212428892 212431415 0 4462
8 TraesCS7B01G457000 chr6B 98.372 2519 41 0 1 2519 128889960 128887442 0 4425
9 TraesCS7B01G457000 chr5B 98.253 2519 43 1 1 2519 713112939 713110422 0 4407


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G457000 chr7B 716793297 716795815 2518 True 4652 4652 100.000 1 2519 1 chr7B.!!$R3 2518
1 TraesCS7B01G457000 chr7B 698124393 698126910 2517 True 4495 4495 98.888 1 2519 1 chr7B.!!$R2 2518
2 TraesCS7B01G457000 chr7B 742937505 742940019 2514 False 4427 4427 98.412 1 2519 1 chr7B.!!$F1 2518
3 TraesCS7B01G457000 chr7B 139617071 139619594 2523 True 4058 4058 95.723 1 2519 1 chr7B.!!$R1 2518
4 TraesCS7B01G457000 chrUn 233522727 233525244 2517 True 4490 4490 98.849 1 2519 1 chrUn.!!$R1 2518
5 TraesCS7B01G457000 chrUn 257944136 257946658 2522 False 4473 4473 98.693 1 2519 1 chrUn.!!$F1 2518
6 TraesCS7B01G457000 chr7A 60093657 60096175 2518 True 4481 4481 98.769 1 2519 1 chr7A.!!$R1 2518
7 TraesCS7B01G457000 chr1D 212428892 212431415 2523 False 4462 4462 98.613 1 2519 1 chr1D.!!$F1 2518
8 TraesCS7B01G457000 chr6B 128887442 128889960 2518 True 4425 4425 98.372 1 2519 1 chr6B.!!$R1 2518
9 TraesCS7B01G457000 chr5B 713110422 713112939 2517 True 4407 4407 98.253 1 2519 1 chr5B.!!$R1 2518

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
307 309 3.201363 TGGGAATTGAAGAGGGGAGAAT 58.799 45.455 0.0 0.0 0.0 2.4 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2211 2221 1.177401 GCTCCACATTCCACCCTTTC 58.823 55.0 0.0 0.0 0.0 2.62 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
49 50 8.475639 GTTTGGAGAGGTGTAGATTGTAGATTA 58.524 37.037 0.00 0.0 0.00 1.75
307 309 3.201363 TGGGAATTGAAGAGGGGAGAAT 58.799 45.455 0.00 0.0 0.00 2.40
469 471 4.319911 CCGAAAGAACAAGCAACGGATTTA 60.320 41.667 0.00 0.0 41.09 1.40
1161 1170 6.602278 ACTTCCACTAGATTTTTATAGGGGC 58.398 40.000 0.00 0.0 41.59 5.80
1283 1292 1.152546 AGCAAGTTGGGTTGGGGTC 60.153 57.895 4.75 0.0 0.00 4.46
1473 1483 3.764885 ATTCTTATTGTGCGCCTTGTC 57.235 42.857 4.18 0.0 0.00 3.18
1639 1649 3.006728 CGGGGCACAAGGGTCCTA 61.007 66.667 0.00 0.0 0.00 2.94
2209 2219 4.338118 TGACTGCCTTTTTCGTCAGAAATT 59.662 37.500 0.00 0.0 44.82 1.82
2211 2221 6.002062 ACTGCCTTTTTCGTCAGAAATTAG 57.998 37.500 0.00 0.0 44.82 1.73
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
49 50 0.832135 TTCCTGGTCTTCTCGGCTGT 60.832 55.000 0.00 0.00 0.00 4.40
307 309 2.654749 AATCGTTCGATGTCTGCTCA 57.345 45.000 8.46 0.00 0.00 4.26
385 387 6.092259 GTCCTTGCATTAGTATGAGTTCGTTT 59.908 38.462 0.00 0.00 33.37 3.60
469 471 0.253044 TTTAGCAAGGGATGAGCGCT 59.747 50.000 11.27 11.27 42.29 5.92
609 611 0.389391 CAGACGTGGAGTGGTGAAGT 59.611 55.000 0.00 0.00 0.00 3.01
940 949 1.469703 TCACATCAATTGAAGCAGGCG 59.530 47.619 13.09 0.00 0.00 5.52
1161 1170 3.117738 ACAGCATATCTTTTCCCTCCTGG 60.118 47.826 0.00 0.00 0.00 4.45
1473 1483 2.480555 GCGGATCCAAACGTGCTG 59.519 61.111 13.41 0.00 0.00 4.41
1639 1649 1.183549 CTTCGCACCTGGGTAGTACT 58.816 55.000 0.00 0.00 0.00 2.73
2161 2171 2.436911 GTCGCCCCCTTTCCTATTTAGA 59.563 50.000 0.00 0.00 0.00 2.10
2209 2219 2.026262 GCTCCACATTCCACCCTTTCTA 60.026 50.000 0.00 0.00 0.00 2.10
2211 2221 1.177401 GCTCCACATTCCACCCTTTC 58.823 55.000 0.00 0.00 0.00 2.62
2293 2303 1.877672 TTCCCCTGGTAGTCCCGCTA 61.878 60.000 0.00 0.00 35.15 4.26
2350 2360 4.616953 TCTAAATCTCGAATATGCGCACA 58.383 39.130 14.90 0.00 0.00 4.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.