Multiple sequence alignment - TraesCS7B01G456900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G456900 chr7B 100.000 2342 0 0 1 2342 716784508 716786849 0.000000e+00 4325
1 TraesCS7B01G456900 chr7B 99.231 2342 18 0 1 2342 742948837 742946496 0.000000e+00 4226
2 TraesCS7B01G456900 chr7B 96.360 2308 67 4 38 2342 139608300 139610593 0.000000e+00 3781
3 TraesCS7B01G456900 chr5A 99.402 2342 14 0 1 2342 16544455 16546796 0.000000e+00 4248
4 TraesCS7B01G456900 chr5A 98.719 2342 18 1 1 2342 420185603 420187932 0.000000e+00 4148
5 TraesCS7B01G456900 chr7A 99.317 2342 16 0 1 2342 60168866 60166525 0.000000e+00 4237
6 TraesCS7B01G456900 chr7A 99.274 2342 17 0 1 2342 60084837 60087178 0.000000e+00 4231
7 TraesCS7B01G456900 chr7A 96.899 129 3 1 2085 2212 627151653 627151781 5.070000e-52 215
8 TraesCS7B01G456900 chr1D 98.155 2331 40 2 1 2329 275778829 275781158 0.000000e+00 4063
9 TraesCS7B01G456900 chr6B 97.225 2342 51 3 1 2342 388287136 388284809 0.000000e+00 3952
10 TraesCS7B01G456900 chr2D 96.159 2343 68 8 1 2342 291773520 291775841 0.000000e+00 3808
11 TraesCS7B01G456900 chr4A 94.727 1043 42 4 1300 2342 698563523 698562494 0.000000e+00 1609
12 TraesCS7B01G456900 chr2B 97.525 202 5 0 2141 2342 102608845 102609046 1.720000e-91 346
13 TraesCS7B01G456900 chr2B 96.875 64 2 0 2279 2342 329490794 329490857 8.850000e-20 108
14 TraesCS7B01G456900 chr2A 92.308 130 10 0 1970 2099 6317750 6317879 3.970000e-43 185


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G456900 chr7B 716784508 716786849 2341 False 4325 4325 100.000 1 2342 1 chr7B.!!$F2 2341
1 TraesCS7B01G456900 chr7B 742946496 742948837 2341 True 4226 4226 99.231 1 2342 1 chr7B.!!$R1 2341
2 TraesCS7B01G456900 chr7B 139608300 139610593 2293 False 3781 3781 96.360 38 2342 1 chr7B.!!$F1 2304
3 TraesCS7B01G456900 chr5A 16544455 16546796 2341 False 4248 4248 99.402 1 2342 1 chr5A.!!$F1 2341
4 TraesCS7B01G456900 chr5A 420185603 420187932 2329 False 4148 4148 98.719 1 2342 1 chr5A.!!$F2 2341
5 TraesCS7B01G456900 chr7A 60166525 60168866 2341 True 4237 4237 99.317 1 2342 1 chr7A.!!$R1 2341
6 TraesCS7B01G456900 chr7A 60084837 60087178 2341 False 4231 4231 99.274 1 2342 1 chr7A.!!$F1 2341
7 TraesCS7B01G456900 chr1D 275778829 275781158 2329 False 4063 4063 98.155 1 2329 1 chr1D.!!$F1 2328
8 TraesCS7B01G456900 chr6B 388284809 388287136 2327 True 3952 3952 97.225 1 2342 1 chr6B.!!$R1 2341
9 TraesCS7B01G456900 chr2D 291773520 291775841 2321 False 3808 3808 96.159 1 2342 1 chr2D.!!$F1 2341
10 TraesCS7B01G456900 chr4A 698562494 698563523 1029 True 1609 1609 94.727 1300 2342 1 chr4A.!!$R1 1042

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
274 275 5.848036 CAGTTGAAAGCTATGAAACAAGTCG 59.152 40.0 0.0 0.0 0.0 4.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1807 1813 2.621338 TCACGCATGGCTTTCTCTAAG 58.379 47.619 0.0 0.0 36.9 2.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
274 275 5.848036 CAGTTGAAAGCTATGAAACAAGTCG 59.152 40.0 0.0 0.0 0.0 4.18
1807 1813 5.505819 GGTCTTTAATTCGGCATTAGCTTCC 60.506 44.0 0.0 0.0 41.7 3.46
2277 2285 5.888161 AGTTCTGAAGCTCCTTTCTTTCAAA 59.112 36.0 0.0 0.0 0.0 2.69
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
274 275 1.886886 TCCAGTTTTGAACTACCGCC 58.113 50.000 0.0 0.0 40.46 6.13
473 474 3.638627 TCTGTCTAGTGGCATTCGATCAT 59.361 43.478 0.0 0.0 0.00 2.45
1807 1813 2.621338 TCACGCATGGCTTTCTCTAAG 58.379 47.619 0.0 0.0 36.90 2.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.