Multiple sequence alignment - TraesCS7B01G456800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G456800 chr7B 100.000 3530 0 0 1 3530 716782615 716786144 0 6519
1 TraesCS7B01G456800 chr7B 98.952 3531 35 2 1 3530 742950730 742947201 0 6314
2 TraesCS7B01G456800 chr7A 98.867 3531 38 2 1 3530 60170759 60167230 0 6298
3 TraesCS7B01G456800 chr7A 99.017 3356 30 3 175 3530 60083121 60086473 0 6011
4 TraesCS7B01G456800 chr5A 98.697 3531 43 3 1 3530 420183711 420187239 0 6263
5 TraesCS7B01G456800 chr5A 98.968 3489 34 2 43 3530 16542604 16546091 0 6242
6 TraesCS7B01G456800 chr2A 98.646 3470 46 1 1 3469 755478556 755482025 0 6146
7 TraesCS7B01G456800 chr6B 97.536 3531 83 4 1 3530 388289028 388285501 0 6035
8 TraesCS7B01G456800 chr4D 98.213 3301 55 4 1 3299 123348130 123351428 0 5766
9 TraesCS7B01G456800 chr2D 96.178 3532 116 9 1 3530 291771628 291775142 0 5757
10 TraesCS7B01G456800 chr5B 98.246 399 6 1 3132 3530 680040521 680040918 0 697


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G456800 chr7B 716782615 716786144 3529 False 6519 6519 100.000 1 3530 1 chr7B.!!$F1 3529
1 TraesCS7B01G456800 chr7B 742947201 742950730 3529 True 6314 6314 98.952 1 3530 1 chr7B.!!$R1 3529
2 TraesCS7B01G456800 chr7A 60167230 60170759 3529 True 6298 6298 98.867 1 3530 1 chr7A.!!$R1 3529
3 TraesCS7B01G456800 chr7A 60083121 60086473 3352 False 6011 6011 99.017 175 3530 1 chr7A.!!$F1 3355
4 TraesCS7B01G456800 chr5A 420183711 420187239 3528 False 6263 6263 98.697 1 3530 1 chr5A.!!$F2 3529
5 TraesCS7B01G456800 chr5A 16542604 16546091 3487 False 6242 6242 98.968 43 3530 1 chr5A.!!$F1 3487
6 TraesCS7B01G456800 chr2A 755478556 755482025 3469 False 6146 6146 98.646 1 3469 1 chr2A.!!$F1 3468
7 TraesCS7B01G456800 chr6B 388285501 388289028 3527 True 6035 6035 97.536 1 3530 1 chr6B.!!$R1 3529
8 TraesCS7B01G456800 chr4D 123348130 123351428 3298 False 5766 5766 98.213 1 3299 1 chr4D.!!$F1 3298
9 TraesCS7B01G456800 chr2D 291771628 291775142 3514 False 5757 5757 96.178 1 3530 1 chr2D.!!$F1 3529

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
800 804 2.116827 TTTGGTATGGGTACGCTTGG 57.883 50.000 11.59 0.0 0.00 3.61 F
1180 1184 0.963355 GGTGGAATTTGCCAGCGGTA 60.963 55.000 0.00 0.0 45.32 4.02 F
1641 1645 1.334599 GCGATTGGACAAAAACGCTCA 60.335 47.619 19.05 0.0 37.90 4.26 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2167 2171 1.886886 TCCAGTTTTGAACTACCGCC 58.113 50.000 0.0 0.0 40.46 6.13 R
2366 2370 3.638627 TCTGTCTAGTGGCATTCGATCAT 59.361 43.478 0.0 0.0 0.00 2.45 R
3075 3080 4.394920 GCCACGGAATGAATCAAAGAACTA 59.605 41.667 0.0 0.0 0.00 2.24 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
99 100 2.915079 CCCGCCATGTACCATCCA 59.085 61.111 0.00 0.00 0.00 3.41
269 271 5.883673 TGGTACAAACAAGTTCAAAGCTAGT 59.116 36.000 0.00 0.00 31.92 2.57
385 387 9.415544 GATCAAAAATTCCACTATCAATATGGC 57.584 33.333 0.00 0.00 33.20 4.40
584 586 4.512571 CCAATCGATCATCACTTGCATACA 59.487 41.667 0.00 0.00 0.00 2.29
762 766 2.582498 CCTAGTCGAAAGCGCCCG 60.582 66.667 2.29 5.86 37.46 6.13
783 787 6.638063 GCCCGTAAAAAGAGTAAATCGTTTTT 59.362 34.615 7.35 1.90 44.06 1.94
798 802 2.485038 CGTTTTTGGTATGGGTACGCTT 59.515 45.455 11.59 7.49 0.00 4.68
800 804 2.116827 TTTGGTATGGGTACGCTTGG 57.883 50.000 11.59 0.00 0.00 3.61
977 981 4.884164 AGCGGATTTCTCCCTTCAAAATAG 59.116 41.667 0.00 0.00 38.45 1.73
1134 1138 1.134175 GGGATTGCACGTGTTTATGGG 59.866 52.381 18.38 0.00 0.00 4.00
1180 1184 0.963355 GGTGGAATTTGCCAGCGGTA 60.963 55.000 0.00 0.00 45.32 4.02
1245 1249 7.604927 GGTATTGTTGTCTTTGGTAGTGATACA 59.395 37.037 0.00 0.00 0.00 2.29
1301 1305 4.474651 TGGATCTATTGTGGATGTTCCTGT 59.525 41.667 0.00 0.00 37.46 4.00
1641 1645 1.334599 GCGATTGGACAAAAACGCTCA 60.335 47.619 19.05 0.00 37.90 4.26
2167 2171 5.848036 CAGTTGAAAGCTATGAAACAAGTCG 59.152 40.000 0.00 0.00 0.00 4.18
3075 3080 2.037511 TGTCGGTATTGGAAACGTCCTT 59.962 45.455 0.00 0.00 45.22 3.36
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
99 100 4.166144 CCAATAACCCACTACTTCCTCCAT 59.834 45.833 0.00 0.00 0.00 3.41
269 271 5.854010 ATCTACCGTTCTTTATGCTCTCA 57.146 39.130 0.00 0.00 0.00 3.27
385 387 8.574251 TTCTCTTTCTAGATATAGCAGCCTAG 57.426 38.462 0.00 0.00 0.00 3.02
783 787 1.222387 GCCAAGCGTACCCATACCA 59.778 57.895 0.00 0.00 0.00 3.25
977 981 9.683069 CCATACTTTAACAAATTAGATGGATGC 57.317 33.333 0.00 0.00 0.00 3.91
1245 1249 8.083828 TGACAAGATCTCCTTCTTTAATAGCT 57.916 34.615 0.00 0.00 33.69 3.32
1301 1305 0.324275 GCCTAACATGGCCTTTCCCA 60.324 55.000 3.32 0.00 46.82 4.37
1641 1645 5.590530 TTTGAACTAATTGTGCCACAGTT 57.409 34.783 10.54 10.54 32.66 3.16
1879 1883 2.538141 CCCCTGGGAAAGCCTCACA 61.538 63.158 16.20 0.00 35.61 3.58
2167 2171 1.886886 TCCAGTTTTGAACTACCGCC 58.113 50.000 0.00 0.00 40.46 6.13
2366 2370 3.638627 TCTGTCTAGTGGCATTCGATCAT 59.361 43.478 0.00 0.00 0.00 2.45
3075 3080 4.394920 GCCACGGAATGAATCAAAGAACTA 59.605 41.667 0.00 0.00 0.00 2.24


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.