Multiple sequence alignment - TraesCS7B01G456700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G456700 chr7B 100.000 3354 0 0 1 3354 716778896 716775543 0 6194
1 TraesCS7B01G456700 chr7B 98.987 3355 33 1 1 3354 716910713 716907359 0 6006
2 TraesCS7B01G456700 chr7B 98.867 3355 36 2 1 3354 742954450 742957803 0 5984
3 TraesCS7B01G456700 chr7A 98.957 3356 33 2 1 3354 60349348 60345993 0 6002
4 TraesCS7B01G456700 chr5A 98.957 3355 34 1 1 3354 16538870 16535516 0 6000
5 TraesCS7B01G456700 chr2B 98.629 3356 43 3 1 3354 391172732 391169378 0 5939
6 TraesCS7B01G456700 chr1B 98.599 3355 45 2 1 3354 583567260 583570613 0 5934
7 TraesCS7B01G456700 chr3B 97.796 3358 70 2 1 3354 39847344 39843987 0 5788


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G456700 chr7B 716775543 716778896 3353 True 6194 6194 100.000 1 3354 1 chr7B.!!$R1 3353
1 TraesCS7B01G456700 chr7B 716907359 716910713 3354 True 6006 6006 98.987 1 3354 1 chr7B.!!$R2 3353
2 TraesCS7B01G456700 chr7B 742954450 742957803 3353 False 5984 5984 98.867 1 3354 1 chr7B.!!$F1 3353
3 TraesCS7B01G456700 chr7A 60345993 60349348 3355 True 6002 6002 98.957 1 3354 1 chr7A.!!$R1 3353
4 TraesCS7B01G456700 chr5A 16535516 16538870 3354 True 6000 6000 98.957 1 3354 1 chr5A.!!$R1 3353
5 TraesCS7B01G456700 chr2B 391169378 391172732 3354 True 5939 5939 98.629 1 3354 1 chr2B.!!$R1 3353
6 TraesCS7B01G456700 chr1B 583567260 583570613 3353 False 5934 5934 98.599 1 3354 1 chr1B.!!$F1 3353
7 TraesCS7B01G456700 chr3B 39843987 39847344 3357 True 5788 5788 97.796 1 3354 1 chr3B.!!$R1 3353

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
121 123 0.824759 GGATCACAGGGCTAAGTCGT 59.175 55.0 0.00 0.0 0.00 4.34 F
1575 1581 0.041535 TCGCTTTCTAGGTACCCCCA 59.958 55.0 8.74 0.0 34.66 4.96 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1585 1591 0.465097 CCCAGCTCAAAGGCGATGAT 60.465 55.000 0.0 0.0 37.29 2.45 R
2695 2701 1.271597 GCTGGGTGTCAAAGTCCTCAT 60.272 52.381 0.0 0.0 0.00 2.90 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
121 123 0.824759 GGATCACAGGGCTAAGTCGT 59.175 55.000 0.00 0.00 0.00 4.34
815 817 3.218398 CGAAGACGAACTTGCATTTGTC 58.782 45.455 11.12 11.12 41.55 3.18
1257 1263 6.732531 TGCATATGAGAGAACTTCAAACTG 57.267 37.500 6.97 0.00 0.00 3.16
1365 1371 7.566760 TGTTTGGATTAGATGTCGCAATATT 57.433 32.000 0.00 0.00 0.00 1.28
1502 1508 1.329599 GTTCGTTCAAAGTCGGCAAGT 59.670 47.619 0.00 0.00 0.00 3.16
1575 1581 0.041535 TCGCTTTCTAGGTACCCCCA 59.958 55.000 8.74 0.00 34.66 4.96
1585 1591 5.237935 TCTAGGTACCCCCAGATCTACTAA 58.762 45.833 8.74 0.00 34.66 2.24
1762 1768 2.434185 TACGCTGGCGCTCTTTGG 60.434 61.111 15.04 0.00 44.19 3.28
2643 2649 6.627508 CGTCCACCTACAACTAATAAAGCTCT 60.628 42.308 0.00 0.00 0.00 4.09
2695 2701 3.955524 TTGAAGGACCAAACCACCTAA 57.044 42.857 0.00 0.00 33.34 2.69
3071 3077 8.121305 TGCAACCAAATTCACTATTGACTTAT 57.879 30.769 0.00 0.00 0.00 1.73
3157 3163 5.483937 TCTTCCTCTTAGTGCTACAAATGGA 59.516 40.000 0.00 0.00 0.00 3.41
3309 3315 1.002142 TCACCGTATCGCGTCCAATAG 60.002 52.381 5.77 0.00 39.32 1.73
3317 3323 2.227194 TCGCGTCCAATAGAGCTATGA 58.773 47.619 5.77 0.00 0.00 2.15
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
121 123 3.439857 AAAGAAGGTTCTGGCATGCTA 57.560 42.857 18.92 11.28 37.65 3.49
482 484 1.343069 AAAGGAGACGAGGCTTCTGT 58.657 50.000 0.00 0.00 0.00 3.41
1365 1371 6.769512 AGAAAGAGCTGAAATACTACAACCA 58.230 36.000 0.00 0.00 0.00 3.67
1502 1508 4.934797 AACATCCCTTTCTCTGATTCCA 57.065 40.909 0.00 0.00 0.00 3.53
1575 1581 6.656632 TCAAAGGCGATGATTAGTAGATCT 57.343 37.500 0.00 0.00 0.00 2.75
1585 1591 0.465097 CCCAGCTCAAAGGCGATGAT 60.465 55.000 0.00 0.00 37.29 2.45
1762 1768 6.406692 TCAGGGTTGTAGATAATGCTCTAC 57.593 41.667 4.35 4.35 45.18 2.59
2643 2649 2.032965 TGTAGTAGTCCCCAAAGGCA 57.967 50.000 0.00 0.00 34.51 4.75
2695 2701 1.271597 GCTGGGTGTCAAAGTCCTCAT 60.272 52.381 0.00 0.00 0.00 2.90
3071 3077 4.951715 AGGAATGAAGCATGCATAAACTCA 59.048 37.500 21.98 12.03 27.94 3.41
3309 3315 3.931578 AGGTCAACTTGTGTCATAGCTC 58.068 45.455 0.00 0.00 0.00 4.09


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.