Multiple sequence alignment - TraesCS7B01G454500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G454500 chr7B 100.000 3575 0 0 1 3575 715156391 715152817 0.000000e+00 6602
1 TraesCS7B01G454500 chr7B 99.469 3576 18 1 1 3575 715123711 715120136 0.000000e+00 6497
2 TraesCS7B01G454500 chr7B 98.630 3577 37 7 1 3575 715084315 715080749 0.000000e+00 6324
3 TraesCS7B01G454500 chr7B 96.930 3583 59 9 3 3575 714902014 714898473 0.000000e+00 5960
4 TraesCS7B01G454500 chr7B 98.073 1764 25 5 1813 3575 714947476 714945721 0.000000e+00 3061
5 TraesCS7B01G454500 chr7B 86.908 1795 155 33 812 2576 715322453 715320709 0.000000e+00 1940
6 TraesCS7B01G454500 chr7B 95.932 1180 35 7 644 1815 714950521 714949347 0.000000e+00 1901
7 TraesCS7B01G454500 chr7B 93.228 635 21 4 2349 2983 714845000 714844388 0.000000e+00 915
8 TraesCS7B01G454500 chr7B 96.379 359 12 1 3047 3404 714844385 714844027 1.110000e-164 590
9 TraesCS7B01G454500 chr7B 90.110 182 14 4 1 179 714950697 714950517 2.150000e-57 233
10 TraesCS7B01G454500 chr7B 88.824 170 1 2 3406 3575 714843991 714843840 3.640000e-45 193
11 TraesCS7B01G454500 chr4A 94.142 2219 86 12 644 2857 700430228 700428049 0.000000e+00 3338
12 TraesCS7B01G454500 chr4A 95.763 118 4 1 63 179 700430341 700430224 4.710000e-44 189
13 TraesCS7B01G454500 chr4A 98.551 69 1 0 1 69 700430979 700430911 4.850000e-24 122
14 TraesCS7B01G454500 chr7D 87.039 1844 165 45 769 2573 619581941 619583749 0.000000e+00 2013
15 TraesCS7B01G454500 chr7D 86.218 1843 171 46 769 2573 620583009 620584806 0.000000e+00 1919
16 TraesCS7B01G454500 chr7D 93.490 553 22 8 2857 3404 495333978 495333435 0.000000e+00 809
17 TraesCS7B01G454500 chr7D 93.450 458 22 5 1084 1541 619359201 619358752 0.000000e+00 673
18 TraesCS7B01G454500 chr7D 92.148 433 21 9 730 1160 619359590 619359169 1.840000e-167 599
19 TraesCS7B01G454500 chr7D 93.642 173 7 2 3407 3575 495333398 495333226 4.580000e-64 255
20 TraesCS7B01G454500 chr7D 87.500 160 18 2 22 179 619384479 619384320 2.190000e-42 183
21 TraesCS7B01G454500 chr7A 86.818 1851 173 35 769 2573 713833345 713835170 0.000000e+00 2001
22 TraesCS7B01G454500 chrUn 87.374 1394 113 37 734 2097 93249919 93248559 0.000000e+00 1541
23 TraesCS7B01G454500 chr1D 93.074 462 30 2 181 641 483885861 483886321 0.000000e+00 675
24 TraesCS7B01G454500 chr1D 92.275 466 34 2 178 642 35755962 35756426 0.000000e+00 660
25 TraesCS7B01G454500 chr4D 93.059 461 30 2 184 643 4343376 4342917 0.000000e+00 673
26 TraesCS7B01G454500 chr4D 92.857 462 28 4 181 641 494790352 494789895 0.000000e+00 665
27 TraesCS7B01G454500 chr2B 93.059 461 30 2 184 643 763334029 763333570 0.000000e+00 673
28 TraesCS7B01G454500 chr6A 92.111 469 35 2 178 645 588045766 588046233 0.000000e+00 660
29 TraesCS7B01G454500 chr3B 93.878 294 17 1 3112 3404 284636949 284637242 3.280000e-120 442
30 TraesCS7B01G454500 chr3B 94.094 254 12 2 2858 3111 284636647 284636897 2.010000e-102 383
31 TraesCS7B01G454500 chr3B 96.988 166 5 0 3407 3572 284637279 284637444 2.720000e-71 279


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G454500 chr7B 715152817 715156391 3574 True 6602.000000 6602 100.000000 1 3575 1 chr7B.!!$R4 3574
1 TraesCS7B01G454500 chr7B 715120136 715123711 3575 True 6497.000000 6497 99.469000 1 3575 1 chr7B.!!$R3 3574
2 TraesCS7B01G454500 chr7B 715080749 715084315 3566 True 6324.000000 6324 98.630000 1 3575 1 chr7B.!!$R2 3574
3 TraesCS7B01G454500 chr7B 714898473 714902014 3541 True 5960.000000 5960 96.930000 3 3575 1 chr7B.!!$R1 3572
4 TraesCS7B01G454500 chr7B 715320709 715322453 1744 True 1940.000000 1940 86.908000 812 2576 1 chr7B.!!$R5 1764
5 TraesCS7B01G454500 chr7B 714945721 714950697 4976 True 1731.666667 3061 94.705000 1 3575 3 chr7B.!!$R7 3574
6 TraesCS7B01G454500 chr7B 714843840 714845000 1160 True 566.000000 915 92.810333 2349 3575 3 chr7B.!!$R6 1226
7 TraesCS7B01G454500 chr4A 700428049 700430979 2930 True 1216.333333 3338 96.152000 1 2857 3 chr4A.!!$R1 2856
8 TraesCS7B01G454500 chr7D 619581941 619583749 1808 False 2013.000000 2013 87.039000 769 2573 1 chr7D.!!$F1 1804
9 TraesCS7B01G454500 chr7D 620583009 620584806 1797 False 1919.000000 1919 86.218000 769 2573 1 chr7D.!!$F2 1804
10 TraesCS7B01G454500 chr7D 619358752 619359590 838 True 636.000000 673 92.799000 730 1541 2 chr7D.!!$R3 811
11 TraesCS7B01G454500 chr7D 495333226 495333978 752 True 532.000000 809 93.566000 2857 3575 2 chr7D.!!$R2 718
12 TraesCS7B01G454500 chr7A 713833345 713835170 1825 False 2001.000000 2001 86.818000 769 2573 1 chr7A.!!$F1 1804
13 TraesCS7B01G454500 chrUn 93248559 93249919 1360 True 1541.000000 1541 87.374000 734 2097 1 chrUn.!!$R1 1363
14 TraesCS7B01G454500 chr3B 284636647 284637444 797 False 368.000000 442 94.986667 2858 3572 3 chr3B.!!$F1 714

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
900 1958 7.488205 TCTTCCTCCTACAAATATAGCCCTAT 58.512 38.462 0.0 0.0 0.00 2.57 F
2214 5236 3.834813 TCTACTCAGCCTTCACTGACATT 59.165 43.478 0.0 0.0 41.72 2.71 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2214 5236 1.195442 TACCAGGGGCGTGATTGACA 61.195 55.000 0.0 0.0 0.0 3.58 R
3414 6564 1.964223 GATCTCACCCGAGCCATTAGA 59.036 52.381 0.0 0.0 39.3 2.10 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
900 1958 7.488205 TCTTCCTCCTACAAATATAGCCCTAT 58.512 38.462 0.0 0.0 0.00 2.57
2214 5236 3.834813 TCTACTCAGCCTTCACTGACATT 59.165 43.478 0.0 0.0 41.72 2.71
2696 5731 6.273071 ACTTGTGTTTTGATGGAGTTTTAGC 58.727 36.000 0.0 0.0 0.00 3.09
2983 6037 1.546476 AGATCGTCTGTGGTCCAAGTC 59.454 52.381 0.0 0.0 0.00 3.01
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
900 1958 4.028490 GGGATCGTGGTGTGGGCA 62.028 66.667 0.0 0.0 0.00 5.36
2214 5236 1.195442 TACCAGGGGCGTGATTGACA 61.195 55.000 0.0 0.0 0.00 3.58
2983 6037 0.868406 GCAACTTCCAGGTTGAGACG 59.132 55.000 10.9 0.0 46.55 4.18
3414 6564 1.964223 GATCTCACCCGAGCCATTAGA 59.036 52.381 0.0 0.0 39.30 2.10


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.