Multiple sequence alignment - TraesCS7B01G454400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G454400 chr7B 100.000 3714 0 0 1 3714 715123778 715120065 0.000000e+00 6859
1 TraesCS7B01G454400 chr7B 99.461 3714 19 1 1 3714 715156458 715152746 0.000000e+00 6746
2 TraesCS7B01G454400 chr7B 98.520 3715 44 6 1 3714 715084382 715080678 0.000000e+00 6545
3 TraesCS7B01G454400 chr7B 96.804 3723 69 8 1 3714 714902083 714898402 0.000000e+00 6170
4 TraesCS7B01G454400 chr7B 98.311 1835 23 4 1880 3714 714947476 714945650 0.000000e+00 3210
5 TraesCS7B01G454400 chr7B 86.685 1795 159 33 879 2643 715322453 715320709 0.000000e+00 1917
6 TraesCS7B01G454400 chr7B 95.678 1180 38 7 711 1882 714950521 714949347 0.000000e+00 1884
7 TraesCS7B01G454400 chr7B 93.543 635 19 4 2416 3050 714845000 714844388 0.000000e+00 926
8 TraesCS7B01G454400 chr7B 96.379 359 13 0 3114 3472 714844385 714844027 3.190000e-165 592
9 TraesCS7B01G454400 chr7B 91.968 249 16 4 1 246 714950764 714950517 2.750000e-91 346
10 TraesCS7B01G454400 chr7B 91.286 241 3 2 3474 3714 714843991 714843769 2.780000e-81 313
11 TraesCS7B01G454400 chr4A 93.916 2219 91 12 711 2924 700430228 700428049 0.000000e+00 3310
12 TraesCS7B01G454400 chr4A 99.259 135 1 0 2 136 700431045 700430911 1.030000e-60 244
13 TraesCS7B01G454400 chr7D 86.822 1844 169 45 836 2640 619581941 619583749 0.000000e+00 1991
14 TraesCS7B01G454400 chr7D 86.001 1843 175 46 836 2640 620583009 620584806 0.000000e+00 1897
15 TraesCS7B01G454400 chr7D 93.671 553 22 7 2924 3472 495333978 495333435 0.000000e+00 815
16 TraesCS7B01G454400 chr7D 93.013 458 24 5 1151 1608 619359201 619358752 0.000000e+00 662
17 TraesCS7B01G454400 chr7D 92.148 433 21 9 797 1227 619359590 619359169 1.910000e-167 599
18 TraesCS7B01G454400 chr7D 94.215 242 10 2 3475 3712 495333398 495333157 2.110000e-97 366
19 TraesCS7B01G454400 chr7D 87.500 160 18 2 89 246 619384479 619384320 2.280000e-42 183
20 TraesCS7B01G454400 chr7A 86.602 1851 177 35 836 2640 713833345 713835170 0.000000e+00 1978
21 TraesCS7B01G454400 chrUn 87.088 1394 117 37 801 2164 93249919 93248559 0.000000e+00 1519
22 TraesCS7B01G454400 chr1D 92.641 462 32 2 248 708 483885861 483886321 0.000000e+00 664
23 TraesCS7B01G454400 chr1D 92.060 466 35 2 245 709 35755962 35756426 0.000000e+00 654
24 TraesCS7B01G454400 chr4D 92.625 461 32 2 251 710 4343376 4342917 0.000000e+00 662
25 TraesCS7B01G454400 chr4D 92.424 462 30 4 248 708 494790352 494789895 0.000000e+00 654
26 TraesCS7B01G454400 chr2B 92.625 461 32 2 251 710 763334029 763333570 0.000000e+00 662
27 TraesCS7B01G454400 chr6A 92.111 469 35 2 245 712 588045766 588046233 0.000000e+00 660
28 TraesCS7B01G454400 chr3B 93.878 294 18 0 3179 3472 284636949 284637242 9.470000e-121 444
29 TraesCS7B01G454400 chr3B 96.250 240 9 0 3475 3714 284637279 284637518 9.670000e-106 394
30 TraesCS7B01G454400 chr3B 94.488 254 11 2 2925 3178 284636647 284636897 4.500000e-104 388


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G454400 chr7B 715120065 715123778 3713 True 6859.000000 6859 100.0000 1 3714 1 chr7B.!!$R3 3713
1 TraesCS7B01G454400 chr7B 715152746 715156458 3712 True 6746.000000 6746 99.4610 1 3714 1 chr7B.!!$R4 3713
2 TraesCS7B01G454400 chr7B 715080678 715084382 3704 True 6545.000000 6545 98.5200 1 3714 1 chr7B.!!$R2 3713
3 TraesCS7B01G454400 chr7B 714898402 714902083 3681 True 6170.000000 6170 96.8040 1 3714 1 chr7B.!!$R1 3713
4 TraesCS7B01G454400 chr7B 715320709 715322453 1744 True 1917.000000 1917 86.6850 879 2643 1 chr7B.!!$R5 1764
5 TraesCS7B01G454400 chr7B 714945650 714950764 5114 True 1813.333333 3210 95.3190 1 3714 3 chr7B.!!$R7 3713
6 TraesCS7B01G454400 chr7B 714843769 714845000 1231 True 610.333333 926 93.7360 2416 3714 3 chr7B.!!$R6 1298
7 TraesCS7B01G454400 chr4A 700428049 700431045 2996 True 1777.000000 3310 96.5875 2 2924 2 chr4A.!!$R1 2922
8 TraesCS7B01G454400 chr7D 619581941 619583749 1808 False 1991.000000 1991 86.8220 836 2640 1 chr7D.!!$F1 1804
9 TraesCS7B01G454400 chr7D 620583009 620584806 1797 False 1897.000000 1897 86.0010 836 2640 1 chr7D.!!$F2 1804
10 TraesCS7B01G454400 chr7D 619358752 619359590 838 True 630.500000 662 92.5805 797 1608 2 chr7D.!!$R3 811
11 TraesCS7B01G454400 chr7D 495333157 495333978 821 True 590.500000 815 93.9430 2924 3712 2 chr7D.!!$R2 788
12 TraesCS7B01G454400 chr7A 713833345 713835170 1825 False 1978.000000 1978 86.6020 836 2640 1 chr7A.!!$F1 1804
13 TraesCS7B01G454400 chrUn 93248559 93249919 1360 True 1519.000000 1519 87.0880 801 2164 1 chrUn.!!$R1 1363
14 TraesCS7B01G454400 chr3B 284636647 284637518 871 False 408.666667 444 94.8720 2925 3714 3 chr3B.!!$F1 789

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
654 1234 5.262804 AGAGTACGGATCTCAAAGTAAGGT 58.737 41.667 0.0 0.0 34.73 3.50 F
1911 4461 1.084370 CGACATTGAGACCGGCTTCC 61.084 60.000 0.0 0.0 0.00 3.46 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2240 4796 2.028930 AGAGGTCCAGAATGTGAACGTC 60.029 50.000 0.00 0.0 29.87 4.34 R
3288 5969 9.764363 CCATGATATCTAACAAAGCTGTACTTA 57.236 33.333 3.98 0.0 37.75 2.24 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
654 1234 5.262804 AGAGTACGGATCTCAAAGTAAGGT 58.737 41.667 0.00 0.0 34.73 3.50
1160 1794 2.304180 ACTACTTGCTGCCATGTCTTCT 59.696 45.455 0.00 0.0 32.34 2.85
1787 2464 3.246112 ACCCTTGCCGCACAGGTA 61.246 61.111 11.09 0.0 43.70 3.08
1859 2536 2.507102 CACTCCGTCGCGCTCATT 60.507 61.111 5.56 0.0 0.00 2.57
1911 4461 1.084370 CGACATTGAGACCGGCTTCC 61.084 60.000 0.00 0.0 0.00 3.46
2240 4796 3.504863 CAAATGCTTGACGAAAGGGATG 58.495 45.455 0.00 0.0 36.30 3.51
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
227 806 2.158325 ACACCCATTCTCCAACCAACAT 60.158 45.455 0.00 0.0 0.00 2.71
654 1234 3.115390 CCTCTTATCCTCAACCCTCCAA 58.885 50.000 0.00 0.0 0.00 3.53
1160 1794 4.047822 CGCTAGCAACAAACATCCAAAAA 58.952 39.130 16.45 0.0 0.00 1.94
1460 2112 3.961408 AGTGTTGAGATAGGAGCCGTATT 59.039 43.478 0.00 0.0 0.00 1.89
1787 2464 4.016444 TGACAAGCCTCTTGAAAGTTTGT 58.984 39.130 12.89 0.0 0.00 2.83
1911 4461 4.389992 ACTTACATCATCGAAGCTTGTGTG 59.610 41.667 2.10 0.0 0.00 3.82
2240 4796 2.028930 AGAGGTCCAGAATGTGAACGTC 60.029 50.000 0.00 0.0 29.87 4.34
3288 5969 9.764363 CCATGATATCTAACAAAGCTGTACTTA 57.236 33.333 3.98 0.0 37.75 2.24


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.