Multiple sequence alignment - TraesCS7B01G445200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G445200 chr7B 100.000 2288 0 0 1 2288 709128017 709130304 0.000000e+00 4226.0
1 TraesCS7B01G445200 chr7B 96.592 2201 74 1 88 2288 613376213 613374014 0.000000e+00 3648.0
2 TraesCS7B01G445200 chr7B 97.664 856 17 1 1436 2288 616913293 616914148 0.000000e+00 1467.0
3 TraesCS7B01G445200 chr7B 97.052 814 24 0 420 1233 718399559 718400372 0.000000e+00 1371.0
4 TraesCS7B01G445200 chr7B 95.789 190 8 0 2 191 718398957 718399146 7.940000e-80 307.0
5 TraesCS7B01G445200 chr4B 95.584 2287 78 2 2 2288 565111028 565113291 0.000000e+00 3642.0
6 TraesCS7B01G445200 chr4B 96.534 952 33 0 285 1236 10622604 10621653 0.000000e+00 1576.0
7 TraesCS7B01G445200 chr4B 97.897 856 15 1 1436 2288 548862163 548861308 0.000000e+00 1478.0
8 TraesCS7B01G445200 chr4B 95.362 733 31 1 662 1394 273688036 273688765 0.000000e+00 1162.0
9 TraesCS7B01G445200 chr4B 97.222 288 8 0 2 289 10651510 10651223 2.640000e-134 488.0
10 TraesCS7B01G445200 chr4B 93.590 78 5 0 6 83 645906947 645906870 1.440000e-22 117.0
11 TraesCS7B01G445200 chr2B 96.673 1984 65 1 305 2288 29006471 29004489 0.000000e+00 3297.0
12 TraesCS7B01G445200 chr2B 96.552 261 9 0 2 262 29007122 29006862 1.260000e-117 433.0
13 TraesCS7B01G445200 chr2B 96.386 83 3 0 133 215 52189405 52189323 1.100000e-28 137.0
14 TraesCS7B01G445200 chr3B 95.852 1808 73 2 2 1808 16181375 16179569 0.000000e+00 2922.0
15 TraesCS7B01G445200 chr3B 96.483 853 27 1 1436 2285 280585649 280586501 0.000000e+00 1406.0
16 TraesCS7B01G445200 chr3B 95.694 720 28 1 1566 2282 734369063 734369782 0.000000e+00 1155.0
17 TraesCS7B01G445200 chr3B 99.490 392 2 0 1897 2288 16179556 16179165 0.000000e+00 713.0
18 TraesCS7B01G445200 chr6B 94.128 1771 90 7 40 1808 387720728 387718970 0.000000e+00 2682.0
19 TraesCS7B01G445200 chr6B 95.745 893 38 0 340 1232 160387952 160388844 0.000000e+00 1439.0
20 TraesCS7B01G445200 chr6B 97.079 582 14 1 1438 2016 464409820 464410401 0.000000e+00 977.0
21 TraesCS7B01G445200 chr6B 97.710 393 8 1 1897 2288 387718957 387718565 0.000000e+00 675.0
22 TraesCS7B01G445200 chr6B 96.575 146 5 0 2 147 160387431 160387576 2.270000e-60 243.0
23 TraesCS7B01G445200 chr7D 95.636 550 23 1 1740 2288 609065373 609064824 0.000000e+00 881.0
24 TraesCS7B01G445200 chr3D 91.914 371 21 5 299 663 544412424 544412791 5.640000e-141 510.0
25 TraesCS7B01G445200 chr5D 95.324 278 11 2 10 286 448296376 448296652 7.500000e-120 440.0
26 TraesCS7B01G445200 chr5A 95.890 73 2 1 2 73 33142972 33143044 1.440000e-22 117.0
27 TraesCS7B01G445200 chr3A 94.231 52 3 0 1390 1441 681386491 681386542 1.880000e-11 80.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G445200 chr7B 709128017 709130304 2287 False 4226.0 4226 100.0000 1 2288 1 chr7B.!!$F2 2287
1 TraesCS7B01G445200 chr7B 613374014 613376213 2199 True 3648.0 3648 96.5920 88 2288 1 chr7B.!!$R1 2200
2 TraesCS7B01G445200 chr7B 616913293 616914148 855 False 1467.0 1467 97.6640 1436 2288 1 chr7B.!!$F1 852
3 TraesCS7B01G445200 chr7B 718398957 718400372 1415 False 839.0 1371 96.4205 2 1233 2 chr7B.!!$F3 1231
4 TraesCS7B01G445200 chr4B 565111028 565113291 2263 False 3642.0 3642 95.5840 2 2288 1 chr4B.!!$F2 2286
5 TraesCS7B01G445200 chr4B 10621653 10622604 951 True 1576.0 1576 96.5340 285 1236 1 chr4B.!!$R1 951
6 TraesCS7B01G445200 chr4B 548861308 548862163 855 True 1478.0 1478 97.8970 1436 2288 1 chr4B.!!$R3 852
7 TraesCS7B01G445200 chr4B 273688036 273688765 729 False 1162.0 1162 95.3620 662 1394 1 chr4B.!!$F1 732
8 TraesCS7B01G445200 chr2B 29004489 29007122 2633 True 1865.0 3297 96.6125 2 2288 2 chr2B.!!$R2 2286
9 TraesCS7B01G445200 chr3B 16179165 16181375 2210 True 1817.5 2922 97.6710 2 2288 2 chr3B.!!$R1 2286
10 TraesCS7B01G445200 chr3B 280585649 280586501 852 False 1406.0 1406 96.4830 1436 2285 1 chr3B.!!$F1 849
11 TraesCS7B01G445200 chr3B 734369063 734369782 719 False 1155.0 1155 95.6940 1566 2282 1 chr3B.!!$F2 716
12 TraesCS7B01G445200 chr6B 387718565 387720728 2163 True 1678.5 2682 95.9190 40 2288 2 chr6B.!!$R1 2248
13 TraesCS7B01G445200 chr6B 464409820 464410401 581 False 977.0 977 97.0790 1438 2016 1 chr6B.!!$F1 578
14 TraesCS7B01G445200 chr6B 160387431 160388844 1413 False 841.0 1439 96.1600 2 1232 2 chr6B.!!$F2 1230
15 TraesCS7B01G445200 chr7D 609064824 609065373 549 True 881.0 881 95.6360 1740 2288 1 chr7D.!!$R1 548

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
731 1081 0.600782 TTCGTCCCTGTAACCGCAAC 60.601 55.0 0.0 0.0 0.0 4.17 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2147 2505 4.763279 TGTTGCTGCTACAGTACAGTACTA 59.237 41.667 13.12 0.0 37.23 1.82 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
262 263 1.224381 CTCCTCCTTCCCTTCCCCTAT 59.776 57.143 0.00 0.00 0.00 2.57
611 960 5.755849 TCTTCCACTCTGGTTCTTTCTTTT 58.244 37.500 0.00 0.00 39.03 2.27
731 1081 0.600782 TTCGTCCCTGTAACCGCAAC 60.601 55.000 0.00 0.00 0.00 4.17
823 1174 8.867112 TTCGTAATTAAGTAGCAATCGATTCT 57.133 30.769 7.92 10.92 0.00 2.40
838 1189 4.584874 TCGATTCTTGCCATTTGTTAGGA 58.415 39.130 0.00 0.00 0.00 2.94
943 1294 2.618241 TGCTTAGTTTGTGCCTCAACAG 59.382 45.455 0.00 0.00 35.61 3.16
1004 1355 4.415150 ACCAGCCTCCACCATGCG 62.415 66.667 0.00 0.00 0.00 4.73
1143 1494 3.866379 TTGCAGCTCGGCCACCAAT 62.866 57.895 2.24 0.00 0.00 3.16
1208 1560 3.676291 TGGTCACGTTGATGAGAATGA 57.324 42.857 0.00 0.00 0.00 2.57
1233 1585 2.359850 GATGGCCGCTTCACCACA 60.360 61.111 0.00 0.00 39.19 4.17
1240 1592 0.314935 CCGCTTCACCACATTTGCTT 59.685 50.000 0.00 0.00 0.00 3.91
1281 1633 6.150140 GTGCTCAGGTAATCATCTTTCTTGTT 59.850 38.462 0.00 0.00 0.00 2.83
1369 1721 9.774413 TCATGTTACTCTAAGATCAGTCGTATA 57.226 33.333 0.00 0.00 0.00 1.47
1484 1836 1.203162 TCATTGTTGTGAAGGCCCCAT 60.203 47.619 0.00 0.00 0.00 4.00
1831 2186 6.790232 AGTTCCCTCTTCTTATCTCTTCTG 57.210 41.667 0.00 0.00 0.00 3.02
2147 2505 3.632333 TGGAGCACTGTACTATAGCAGT 58.368 45.455 7.08 7.08 45.69 4.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
128 129 1.605165 TTTCGGGCGCTTGGGAAAT 60.605 52.632 7.64 0.0 0.00 2.17
356 705 4.648626 GCCAGCTCCAGTGCCACA 62.649 66.667 0.00 0.0 0.00 4.17
611 960 7.450014 TCTGCTTTTGGGTGTTGATTTTATCTA 59.550 33.333 0.00 0.0 0.00 1.98
823 1174 7.953005 TCTTATCAATCCTAACAAATGGCAA 57.047 32.000 0.00 0.0 0.00 4.52
1004 1355 0.673644 CATGTCACCCACCTCGTTCC 60.674 60.000 0.00 0.0 0.00 3.62
1143 1494 0.758734 CCTTGGCCGTGATGATCCTA 59.241 55.000 0.00 0.0 0.00 2.94
1208 1560 0.394565 GAAGCGGCCATCATAGAGGT 59.605 55.000 2.24 0.0 0.00 3.85
1233 1585 2.814336 GACGAACCCAGAGAAAGCAAAT 59.186 45.455 0.00 0.0 0.00 2.32
1240 1592 1.663739 CACGGACGAACCCAGAGAA 59.336 57.895 0.00 0.0 34.64 2.87
1281 1633 9.898152 TGACCACACATATAGTTCAATCAATAA 57.102 29.630 0.00 0.0 0.00 1.40
1338 1690 9.624697 GACTGATCTTAGAGTAACATGATCATC 57.375 37.037 4.86 0.0 39.29 2.92
1388 1740 7.830099 AGGAAGAAATCTCAGAACAAACAAT 57.170 32.000 0.00 0.0 0.00 2.71
1445 1797 0.107017 ACCTGCAAGCAGAACACACT 60.107 50.000 22.76 0.0 46.30 3.55
1484 1836 0.917333 AAATCCCCCACGCCTTCCTA 60.917 55.000 0.00 0.0 0.00 2.94
1831 2186 6.214399 ACTACTACAACAACTACTGCAAGAC 58.786 40.000 0.00 0.0 37.43 3.01
2147 2505 4.763279 TGTTGCTGCTACAGTACAGTACTA 59.237 41.667 13.12 0.0 37.23 1.82


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.