Multiple sequence alignment - TraesCS7B01G442500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G442500 chr7B 100.000 2264 0 0 1 2264 707572956 707570693 0.000000e+00 4181
1 TraesCS7B01G442500 chr7B 95.599 1636 53 6 647 2263 707617239 707618874 0.000000e+00 2604
2 TraesCS7B01G442500 chr7B 92.768 1756 119 3 1 1750 34282311 34280558 0.000000e+00 2532
3 TraesCS7B01G442500 chr7B 94.239 1597 50 9 651 2215 577211981 577213567 0.000000e+00 2401
4 TraesCS7B01G442500 chr2B 97.536 2273 47 1 1 2264 798600946 798603218 0.000000e+00 3879
5 TraesCS7B01G442500 chr2B 94.790 1593 64 6 651 2234 154584885 154583303 0.000000e+00 2464
6 TraesCS7B01G442500 chr5A 96.493 2224 52 3 1 2215 591473743 591475949 0.000000e+00 3651
7 TraesCS7B01G442500 chr3B 92.487 2183 108 19 1 2133 112909775 112911951 0.000000e+00 3072
8 TraesCS7B01G442500 chr3B 97.653 1704 34 2 1 1704 179362664 179360967 0.000000e+00 2920
9 TraesCS7B01G442500 chr3A 96.640 1756 53 1 1 1750 44774229 44772474 0.000000e+00 2911
10 TraesCS7B01G442500 chr2A 93.109 1756 113 2 1 1750 372742759 372744512 0.000000e+00 2566
11 TraesCS7B01G442500 chr5B 91.923 1758 129 8 1 1750 578837555 578835803 0.000000e+00 2447
12 TraesCS7B01G442500 chr6B 92.605 311 18 1 1910 2215 381312049 381311739 2.060000e-120 442
13 TraesCS7B01G442500 chr1B 92.063 315 16 1 1910 2215 649299293 649298979 3.450000e-118 435
14 TraesCS7B01G442500 chrUn 91.429 315 18 1 1910 2215 361055842 361055528 7.480000e-115 424
15 TraesCS7B01G442500 chrUn 91.429 315 18 1 1910 2215 416567187 416566873 7.480000e-115 424
16 TraesCS7B01G442500 chrUn 90.402 323 22 2 1902 2215 17580370 17580692 1.250000e-112 416


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G442500 chr7B 707570693 707572956 2263 True 4181 4181 100.000 1 2264 1 chr7B.!!$R2 2263
1 TraesCS7B01G442500 chr7B 707617239 707618874 1635 False 2604 2604 95.599 647 2263 1 chr7B.!!$F2 1616
2 TraesCS7B01G442500 chr7B 34280558 34282311 1753 True 2532 2532 92.768 1 1750 1 chr7B.!!$R1 1749
3 TraesCS7B01G442500 chr7B 577211981 577213567 1586 False 2401 2401 94.239 651 2215 1 chr7B.!!$F1 1564
4 TraesCS7B01G442500 chr2B 798600946 798603218 2272 False 3879 3879 97.536 1 2264 1 chr2B.!!$F1 2263
5 TraesCS7B01G442500 chr2B 154583303 154584885 1582 True 2464 2464 94.790 651 2234 1 chr2B.!!$R1 1583
6 TraesCS7B01G442500 chr5A 591473743 591475949 2206 False 3651 3651 96.493 1 2215 1 chr5A.!!$F1 2214
7 TraesCS7B01G442500 chr3B 112909775 112911951 2176 False 3072 3072 92.487 1 2133 1 chr3B.!!$F1 2132
8 TraesCS7B01G442500 chr3B 179360967 179362664 1697 True 2920 2920 97.653 1 1704 1 chr3B.!!$R1 1703
9 TraesCS7B01G442500 chr3A 44772474 44774229 1755 True 2911 2911 96.640 1 1750 1 chr3A.!!$R1 1749
10 TraesCS7B01G442500 chr2A 372742759 372744512 1753 False 2566 2566 93.109 1 1750 1 chr2A.!!$F1 1749
11 TraesCS7B01G442500 chr5B 578835803 578837555 1752 True 2447 2447 91.923 1 1750 1 chr5B.!!$R1 1749

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
153 154 1.120530 AACTGAAGACTCGGTGGTGT 58.879 50.0 0.00 0.0 40.49 4.16 F
768 777 1.668101 CTAGAGGTGGTGGTCGAGCC 61.668 65.0 12.85 4.6 37.90 4.70 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1062 1084 0.542702 CCAAACTGGCCTCCAACCAT 60.543 55.000 3.32 0.0 36.36 3.55 R
1601 1623 2.930950 CCACTTTCCCTTCTTGTCACA 58.069 47.619 0.00 0.0 0.00 3.58 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
153 154 1.120530 AACTGAAGACTCGGTGGTGT 58.879 50.000 0.00 0.00 40.49 4.16
286 287 3.535561 CATGTGGAAGCTACTAGGTTGG 58.464 50.000 5.22 0.00 35.86 3.77
381 382 2.192263 GACCCTCTTCTGAAGGTGGAT 58.808 52.381 23.79 12.85 37.16 3.41
489 490 2.781757 TCATTTCATGGAGGCTCCTGAT 59.218 45.455 32.28 17.18 37.46 2.90
493 494 4.362470 TTCATGGAGGCTCCTGATATTG 57.638 45.455 32.28 19.02 37.46 1.90
768 777 1.668101 CTAGAGGTGGTGGTCGAGCC 61.668 65.000 12.85 4.60 37.90 4.70
1062 1084 0.976641 AAGAGGACATGCCGAAGACA 59.023 50.000 0.00 0.00 43.43 3.41
1460 1482 0.608035 GTCCTTTGCACGGGGATTGA 60.608 55.000 5.02 0.00 0.00 2.57
1601 1623 1.826054 CGAGAGGAGGACGAGGCAT 60.826 63.158 0.00 0.00 0.00 4.40
1999 2064 3.625897 TGGACACCCAGACGCCAG 61.626 66.667 0.00 0.00 37.58 4.85
2251 2339 4.379243 AGCCAGACGCCAAGGTCG 62.379 66.667 2.25 2.25 41.81 4.79
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
153 154 0.255033 TACTAGGCCTCTCGCACTGA 59.745 55.000 9.68 0.00 40.31 3.41
286 287 1.227060 GAAATCTTGGCGCCCATGC 60.227 57.895 26.77 5.80 31.53 4.06
381 382 4.313020 AGTTCTCCTTCTACCCTTCGTA 57.687 45.455 0.00 0.00 0.00 3.43
489 490 2.857483 CACACCCCACAGTTGACAATA 58.143 47.619 0.00 0.00 0.00 1.90
493 494 2.542907 CGCACACCCCACAGTTGAC 61.543 63.158 0.00 0.00 0.00 3.18
768 777 0.459237 CACCTCTAGCACTTGAGCCG 60.459 60.000 3.89 0.00 32.39 5.52
772 781 0.976641 CCACCACCTCTAGCACTTGA 59.023 55.000 0.00 0.00 0.00 3.02
816 825 1.835494 TTCCTCTACGACCACCTCTG 58.165 55.000 0.00 0.00 0.00 3.35
1062 1084 0.542702 CCAAACTGGCCTCCAACCAT 60.543 55.000 3.32 0.00 36.36 3.55
1460 1482 1.806461 TTCTCACGACGCTCCTGCTT 61.806 55.000 0.00 0.00 36.97 3.91
1601 1623 2.930950 CCACTTTCCCTTCTTGTCACA 58.069 47.619 0.00 0.00 0.00 3.58
1878 1934 8.251986 TTGTTTTTGCACAAAGCTTGTTAAAGC 61.252 33.333 0.00 2.21 43.89 3.51


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.