Multiple sequence alignment - TraesCS7B01G436200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G436200 chr7B 100.000 1666 0 0 884 2549 702527739 702526074 0.000000e+00 3077.0
1 TraesCS7B01G436200 chr7B 98.622 1669 20 2 884 2549 552931832 552930164 0.000000e+00 2952.0
2 TraesCS7B01G436200 chr7B 98.501 1668 22 3 884 2549 337148691 337150357 0.000000e+00 2939.0
3 TraesCS7B01G436200 chr7B 100.000 48 0 0 1 48 702528622 702528575 3.490000e-14 89.8
4 TraesCS7B01G436200 chr7A 98.681 1668 20 2 884 2549 701582252 701583919 0.000000e+00 2957.0
5 TraesCS7B01G436200 chr6A 98.792 1656 19 1 884 2538 617222558 617220903 0.000000e+00 2946.0
6 TraesCS7B01G436200 chr6B 98.561 1668 20 4 884 2549 660437432 660435767 0.000000e+00 2944.0
7 TraesCS7B01G436200 chr2B 98.560 1667 18 5 884 2549 25861783 25863444 0.000000e+00 2940.0
8 TraesCS7B01G436200 chr2B 98.443 1670 20 5 884 2549 4740187 4741854 0.000000e+00 2935.0
9 TraesCS7B01G436200 chr5A 98.500 1667 24 1 884 2549 459745192 459746858 0.000000e+00 2939.0
10 TraesCS7B01G436200 chr3A 98.443 1670 20 5 884 2549 722405736 722404069 0.000000e+00 2935.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G436200 chr7B 702526074 702528622 2548 True 1583.4 3077 100.000 1 2549 2 chr7B.!!$R2 2548
1 TraesCS7B01G436200 chr7B 552930164 552931832 1668 True 2952.0 2952 98.622 884 2549 1 chr7B.!!$R1 1665
2 TraesCS7B01G436200 chr7B 337148691 337150357 1666 False 2939.0 2939 98.501 884 2549 1 chr7B.!!$F1 1665
3 TraesCS7B01G436200 chr7A 701582252 701583919 1667 False 2957.0 2957 98.681 884 2549 1 chr7A.!!$F1 1665
4 TraesCS7B01G436200 chr6A 617220903 617222558 1655 True 2946.0 2946 98.792 884 2538 1 chr6A.!!$R1 1654
5 TraesCS7B01G436200 chr6B 660435767 660437432 1665 True 2944.0 2944 98.561 884 2549 1 chr6B.!!$R1 1665
6 TraesCS7B01G436200 chr2B 25861783 25863444 1661 False 2940.0 2940 98.560 884 2549 1 chr2B.!!$F2 1665
7 TraesCS7B01G436200 chr2B 4740187 4741854 1667 False 2935.0 2935 98.443 884 2549 1 chr2B.!!$F1 1665
8 TraesCS7B01G436200 chr5A 459745192 459746858 1666 False 2939.0 2939 98.500 884 2549 1 chr5A.!!$F1 1665
9 TraesCS7B01G436200 chr3A 722404069 722405736 1667 True 2935.0 2935 98.443 884 2549 1 chr3A.!!$R1 1665

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
29 30 4.01805 AGTTGAGAAGTGCCCAATATTCCT 60.018 41.667 0.0 0.0 0.0 3.36 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1724 1727 1.271054 GGACAGAAAGGCAGAGCAGAA 60.271 52.381 0.0 0.0 0.0 3.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
21 22 4.640771 ATCTTAAGTTGAGAAGTGCCCA 57.359 40.909 0.95 0.00 0.00 5.36
22 23 4.431416 TCTTAAGTTGAGAAGTGCCCAA 57.569 40.909 1.63 0.00 0.00 4.12
23 24 4.985538 TCTTAAGTTGAGAAGTGCCCAAT 58.014 39.130 1.63 0.00 0.00 3.16
24 25 6.121776 TCTTAAGTTGAGAAGTGCCCAATA 57.878 37.500 1.63 0.00 0.00 1.90
25 26 6.721318 TCTTAAGTTGAGAAGTGCCCAATAT 58.279 36.000 1.63 0.00 0.00 1.28
26 27 7.175104 TCTTAAGTTGAGAAGTGCCCAATATT 58.825 34.615 1.63 0.00 0.00 1.28
27 28 5.904362 AAGTTGAGAAGTGCCCAATATTC 57.096 39.130 0.00 0.00 0.00 1.75
28 29 4.273318 AGTTGAGAAGTGCCCAATATTCC 58.727 43.478 0.00 0.00 0.00 3.01
29 30 4.018050 AGTTGAGAAGTGCCCAATATTCCT 60.018 41.667 0.00 0.00 0.00 3.36
30 31 5.191722 AGTTGAGAAGTGCCCAATATTCCTA 59.808 40.000 0.00 0.00 0.00 2.94
31 32 5.912149 TGAGAAGTGCCCAATATTCCTAT 57.088 39.130 0.00 0.00 0.00 2.57
32 33 5.869579 TGAGAAGTGCCCAATATTCCTATC 58.130 41.667 0.00 0.00 0.00 2.08
33 34 5.608437 TGAGAAGTGCCCAATATTCCTATCT 59.392 40.000 0.00 0.00 0.00 1.98
34 35 6.101734 TGAGAAGTGCCCAATATTCCTATCTT 59.898 38.462 0.00 0.00 0.00 2.40
35 36 6.538263 AGAAGTGCCCAATATTCCTATCTTC 58.462 40.000 9.37 9.37 0.00 2.87
36 37 5.248380 AGTGCCCAATATTCCTATCTTCC 57.752 43.478 0.00 0.00 0.00 3.46
37 38 4.665009 AGTGCCCAATATTCCTATCTTCCA 59.335 41.667 0.00 0.00 0.00 3.53
38 39 5.006386 GTGCCCAATATTCCTATCTTCCAG 58.994 45.833 0.00 0.00 0.00 3.86
39 40 4.913355 TGCCCAATATTCCTATCTTCCAGA 59.087 41.667 0.00 0.00 0.00 3.86
40 41 5.372363 TGCCCAATATTCCTATCTTCCAGAA 59.628 40.000 0.00 0.00 0.00 3.02
41 42 6.126215 TGCCCAATATTCCTATCTTCCAGAAA 60.126 38.462 0.00 0.00 0.00 2.52
42 43 6.777580 GCCCAATATTCCTATCTTCCAGAAAA 59.222 38.462 0.00 0.00 0.00 2.29
43 44 7.452813 GCCCAATATTCCTATCTTCCAGAAAAT 59.547 37.037 0.00 0.00 0.00 1.82
44 45 9.372189 CCCAATATTCCTATCTTCCAGAAAATT 57.628 33.333 0.00 0.00 0.00 1.82
1193 1196 2.142319 GGCAATTGCACCATTTTCGTT 58.858 42.857 30.32 0.00 44.36 3.85
1724 1727 6.228258 ACTTTTGATCAATGAAATGCAGCTT 58.772 32.000 9.40 0.00 0.00 3.74
2216 2221 1.078708 GGTGTTTAGGGCTGCGCTA 60.079 57.895 20.82 20.82 0.00 4.26
2328 2337 1.064803 GACCGTGAATGTTTGCACACA 59.935 47.619 8.36 8.36 35.03 3.72
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
0 1 4.640771 TGGGCACTTCTCAACTTAAGAT 57.359 40.909 10.09 0.00 0.00 2.40
1 2 4.431416 TTGGGCACTTCTCAACTTAAGA 57.569 40.909 10.09 0.00 0.00 2.10
2 3 7.396540 AATATTGGGCACTTCTCAACTTAAG 57.603 36.000 0.00 0.00 0.00 1.85
3 4 6.377146 GGAATATTGGGCACTTCTCAACTTAA 59.623 38.462 0.00 0.00 0.00 1.85
4 5 5.885912 GGAATATTGGGCACTTCTCAACTTA 59.114 40.000 0.00 0.00 0.00 2.24
5 6 4.706962 GGAATATTGGGCACTTCTCAACTT 59.293 41.667 0.00 0.00 0.00 2.66
6 7 4.018050 AGGAATATTGGGCACTTCTCAACT 60.018 41.667 0.00 0.00 0.00 3.16
7 8 4.273318 AGGAATATTGGGCACTTCTCAAC 58.727 43.478 0.00 0.00 0.00 3.18
8 9 4.591321 AGGAATATTGGGCACTTCTCAA 57.409 40.909 0.00 0.00 0.00 3.02
9 10 5.608437 AGATAGGAATATTGGGCACTTCTCA 59.392 40.000 0.00 0.00 0.00 3.27
10 11 6.120507 AGATAGGAATATTGGGCACTTCTC 57.879 41.667 0.00 0.00 0.00 2.87
11 12 6.466470 GGAAGATAGGAATATTGGGCACTTCT 60.466 42.308 0.00 0.00 33.19 2.85
12 13 5.707764 GGAAGATAGGAATATTGGGCACTTC 59.292 44.000 0.00 0.00 0.00 3.01
13 14 5.134339 TGGAAGATAGGAATATTGGGCACTT 59.866 40.000 0.00 0.00 0.00 3.16
14 15 4.665009 TGGAAGATAGGAATATTGGGCACT 59.335 41.667 0.00 0.00 0.00 4.40
15 16 4.985538 TGGAAGATAGGAATATTGGGCAC 58.014 43.478 0.00 0.00 0.00 5.01
16 17 4.913355 TCTGGAAGATAGGAATATTGGGCA 59.087 41.667 0.00 0.00 38.67 5.36
17 18 5.505181 TCTGGAAGATAGGAATATTGGGC 57.495 43.478 0.00 0.00 38.67 5.36
18 19 8.946797 ATTTTCTGGAAGATAGGAATATTGGG 57.053 34.615 0.00 0.00 46.36 4.12
1193 1196 1.811965 CATTGCTCAAACATCCCGACA 59.188 47.619 0.00 0.00 0.00 4.35
1463 1466 7.392953 CCCAAAAGTATTTGCAAATGGGTATTT 59.607 33.333 30.43 20.23 43.11 1.40
1625 1628 7.976175 GGTCACTTCTTCTCTTTTTGTTTCAAT 59.024 33.333 0.00 0.00 0.00 2.57
1724 1727 1.271054 GGACAGAAAGGCAGAGCAGAA 60.271 52.381 0.00 0.00 0.00 3.02
2174 2179 4.636435 CCACGCGGTCCTGGGTTT 62.636 66.667 12.47 0.00 32.02 3.27
2216 2221 2.032620 CCATCTGTCCTAGCGGTTACT 58.967 52.381 0.00 0.00 0.00 2.24
2328 2337 2.943033 CAAAGGAAAACCACTCTCACGT 59.057 45.455 0.00 0.00 0.00 4.49


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.