Multiple sequence alignment - TraesCS7B01G435200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G435200 chr7B 100.000 3667 0 0 1 3667 702143276 702139610 0.000000e+00 6772
1 TraesCS7B01G435200 chr7B 98.391 3668 55 3 1 3667 701925849 701922185 0.000000e+00 6444
2 TraesCS7B01G435200 chr7B 99.267 2729 19 1 939 3667 702049351 702046624 0.000000e+00 4927
3 TraesCS7B01G435200 chr7B 85.550 1737 184 24 312 2001 702063048 702061332 0.000000e+00 1755
4 TraesCS7B01G435200 chr7B 85.484 1736 186 24 312 2001 701994512 701992797 0.000000e+00 1749
5 TraesCS7B01G435200 chr7B 85.066 1741 187 24 312 1990 701905547 701903818 0.000000e+00 1707
6 TraesCS7B01G435200 chr7B 86.882 1517 160 21 2170 3667 701903799 701902303 0.000000e+00 1663
7 TraesCS7B01G435200 chr7B 84.565 1529 156 33 2163 3667 701992477 701991005 0.000000e+00 1443
8 TraesCS7B01G435200 chr7B 98.867 706 8 0 1 706 702050100 702049395 0.000000e+00 1260
9 TraesCS7B01G435200 chr7D 91.865 3024 153 29 686 3667 612495906 612492934 0.000000e+00 4135
10 TraesCS7B01G435200 chr7D 92.550 2443 135 27 1246 3667 612507541 612505125 0.000000e+00 3459
11 TraesCS7B01G435200 chr7D 87.327 1515 154 22 2170 3667 612516289 612514796 0.000000e+00 1700
12 TraesCS7B01G435200 chr7D 86.134 1601 157 28 426 1984 612518052 612516475 0.000000e+00 1666
13 TraesCS7B01G435200 chr7D 95.738 657 28 0 1 657 612496552 612495896 0.000000e+00 1059
14 TraesCS7B01G435200 chr7D 83.024 754 75 17 426 1150 612518779 612518050 5.170000e-178 634
15 TraesCS7B01G435200 chr7D 96.765 371 12 0 1 371 612508803 612508433 1.450000e-173 619
16 TraesCS7B01G435200 chr7D 94.386 285 16 0 373 657 612508227 612507943 4.350000e-119 438
17 TraesCS7B01G435200 chr7D 96.507 229 8 0 686 914 612507953 612507725 2.670000e-101 379
18 TraesCS7B01G435200 chrUn 92.244 2166 104 14 686 2821 341689511 341691642 0.000000e+00 3011
19 TraesCS7B01G435200 chrUn 86.608 1710 181 23 312 1984 335211268 335209570 0.000000e+00 1845
20 TraesCS7B01G435200 chrUn 87.626 1188 110 15 829 1984 355096430 355095248 0.000000e+00 1345
21 TraesCS7B01G435200 chrUn 88.263 835 81 9 2170 2999 335209492 335208670 0.000000e+00 983
22 TraesCS7B01G435200 chrUn 87.816 673 65 9 3002 3667 83495927 83496589 0.000000e+00 773
23 TraesCS7B01G435200 chrUn 94.386 285 16 0 373 657 341689237 341689521 4.350000e-119 438
24 TraesCS7B01G435200 chr7A 84.032 2029 246 40 5 1984 703000845 702998846 0.000000e+00 1881
25 TraesCS7B01G435200 chr7A 87.483 1510 154 19 2170 3667 702998768 702997282 0.000000e+00 1709


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G435200 chr7B 702139610 702143276 3666 True 6772.000000 6772 100.0000 1 3667 1 chr7B.!!$R3 3666
1 TraesCS7B01G435200 chr7B 701922185 701925849 3664 True 6444.000000 6444 98.3910 1 3667 1 chr7B.!!$R1 3666
2 TraesCS7B01G435200 chr7B 702046624 702050100 3476 True 3093.500000 4927 99.0670 1 3667 2 chr7B.!!$R6 3666
3 TraesCS7B01G435200 chr7B 702061332 702063048 1716 True 1755.000000 1755 85.5500 312 2001 1 chr7B.!!$R2 1689
4 TraesCS7B01G435200 chr7B 701902303 701905547 3244 True 1685.000000 1707 85.9740 312 3667 2 chr7B.!!$R4 3355
5 TraesCS7B01G435200 chr7B 701991005 701994512 3507 True 1596.000000 1749 85.0245 312 3667 2 chr7B.!!$R5 3355
6 TraesCS7B01G435200 chr7D 612492934 612496552 3618 True 2597.000000 4135 93.8015 1 3667 2 chr7D.!!$R1 3666
7 TraesCS7B01G435200 chr7D 612514796 612518779 3983 True 1333.333333 1700 85.4950 426 3667 3 chr7D.!!$R3 3241
8 TraesCS7B01G435200 chr7D 612505125 612508803 3678 True 1223.750000 3459 95.0520 1 3667 4 chr7D.!!$R2 3666
9 TraesCS7B01G435200 chrUn 341689237 341691642 2405 False 1724.500000 3011 93.3150 373 2821 2 chrUn.!!$F2 2448
10 TraesCS7B01G435200 chrUn 335208670 335211268 2598 True 1414.000000 1845 87.4355 312 2999 2 chrUn.!!$R2 2687
11 TraesCS7B01G435200 chrUn 355095248 355096430 1182 True 1345.000000 1345 87.6260 829 1984 1 chrUn.!!$R1 1155
12 TraesCS7B01G435200 chrUn 83495927 83496589 662 False 773.000000 773 87.8160 3002 3667 1 chrUn.!!$F1 665
13 TraesCS7B01G435200 chr7A 702997282 703000845 3563 True 1795.000000 1881 85.7575 5 3667 2 chr7A.!!$R1 3662

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1173 2174 4.680537 ACCAGCGTCCTCTCCCGT 62.681 66.667 0.00 0.0 0.0 5.28 F
2702 3939 6.203723 GTCACAGAAGGCCACATCTAATAATC 59.796 42.308 5.01 0.0 0.0 1.75 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2563 3798 1.612156 CACTTCTTCGAGAGCAGTCG 58.388 55.0 1.48 1.48 41.51 4.18 R
3642 4902 0.031994 CAAAGGGCACTTGAAACCGG 59.968 55.0 0.00 0.00 36.93 5.28 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1173 2174 4.680537 ACCAGCGTCCTCTCCCGT 62.681 66.667 0.00 0.0 0.0 5.28
2702 3939 6.203723 GTCACAGAAGGCCACATCTAATAATC 59.796 42.308 5.01 0.0 0.0 1.75
2893 4132 8.947055 AGTTTTCATTGCTTTTCATGTTTAGT 57.053 26.923 0.00 0.0 0.0 2.24
2911 4161 6.038825 TGTTTAGTGTGGTTGAAATGTGGTAG 59.961 38.462 0.00 0.0 0.0 3.18
3098 4352 4.095932 GGCTTCCGTCCTTACCTTATTTTG 59.904 45.833 0.00 0.0 0.0 2.44
3642 4902 7.797038 ACCGGTGATTATTATGTTAAACCTC 57.203 36.000 6.12 0.0 0.0 3.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
304 307 1.355381 ACTGGATCAGGGTTGAATGCA 59.645 47.619 0.00 0.00 36.78 3.96
1173 2174 4.193334 CAGAGATCGCGCCACCGA 62.193 66.667 0.00 0.00 41.98 4.69
1998 3021 3.064271 GTGTTTTTGAGTCTGCACGGTTA 59.936 43.478 0.00 0.00 0.00 2.85
2563 3798 1.612156 CACTTCTTCGAGAGCAGTCG 58.388 55.000 1.48 1.48 41.51 4.18
2702 3939 6.195868 TGTTATATATTTTTGCGCTTCCACG 58.804 36.000 9.73 0.00 0.00 4.94
2893 4132 3.880490 GTCACTACCACATTTCAACCACA 59.120 43.478 0.00 0.00 0.00 4.17
2911 4161 8.774586 ACAACTAAACTCTAATTGTGATGTCAC 58.225 33.333 6.21 6.21 46.59 3.67
3098 4352 3.737774 GGTCAACAGAAGAATGCAAAAGC 59.262 43.478 0.00 0.00 0.00 3.51
3642 4902 0.031994 CAAAGGGCACTTGAAACCGG 59.968 55.000 0.00 0.00 36.93 5.28


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.