Multiple sequence alignment - TraesCS7B01G435100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G435100 chr7B 100.000 4646 0 0 1 4646 701994870 701990225 0.000000e+00 8580
1 TraesCS7B01G435100 chr7B 99.570 4648 17 3 1 4646 701938674 701934028 0.000000e+00 8469
2 TraesCS7B01G435100 chr7B 97.223 3061 59 5 1 3058 702063408 702060371 0.000000e+00 5158
3 TraesCS7B01G435100 chr7B 98.427 1717 26 1 1342 3058 702155265 702153550 0.000000e+00 3020
4 TraesCS7B01G435100 chr7B 89.781 2329 173 38 2371 4646 701903829 701901513 0.000000e+00 2922
5 TraesCS7B01G435100 chr7B 91.022 2094 133 19 1 2055 701905904 701903827 0.000000e+00 2774
6 TraesCS7B01G435100 chr7B 94.902 1628 53 7 3045 4646 702059910 702058287 0.000000e+00 2519
7 TraesCS7B01G435100 chr7B 94.902 1628 54 6 3045 4646 702153090 702151466 0.000000e+00 2519
8 TraesCS7B01G435100 chr7B 83.671 2174 238 50 2394 4506 701923688 701921571 0.000000e+00 1940
9 TraesCS7B01G435100 chr7B 83.280 2171 255 46 2394 4506 702048128 702046008 0.000000e+00 1899
10 TraesCS7B01G435100 chr7B 92.492 1332 71 10 1 1307 702156679 702155352 0.000000e+00 1879
11 TraesCS7B01G435100 chr7B 87.835 1118 113 14 963 2074 702049390 702048290 0.000000e+00 1290
12 TraesCS7B01G435100 chr7D 90.361 2407 164 26 2288 4646 612516405 612514019 0.000000e+00 3097
13 TraesCS7B01G435100 chr7D 91.019 1659 106 22 471 2109 612518055 612516420 0.000000e+00 2198
14 TraesCS7B01G435100 chr7D 85.208 1609 157 32 2401 3955 612494426 612492845 0.000000e+00 1578
15 TraesCS7B01G435100 chr7D 85.040 1611 158 33 2401 3955 612506619 612505036 0.000000e+00 1563
16 TraesCS7B01G435100 chr7D 90.716 894 65 9 327 1210 612519662 612518777 0.000000e+00 1175
17 TraesCS7B01G435100 chr7D 92.012 338 24 3 1 337 612520021 612519686 5.440000e-129 472
18 TraesCS7B01G435100 chr7D 93.413 167 10 1 2123 2289 235502571 235502406 3.590000e-61 246
19 TraesCS7B01G435100 chr7A 89.921 2401 178 19 2287 4646 702998882 702996505 0.000000e+00 3035
20 TraesCS7B01G435100 chr7A 90.853 1771 121 19 326 2083 703000566 702998824 0.000000e+00 2335
21 TraesCS7B01G435100 chr7A 92.012 338 23 4 1 337 703000958 703000624 5.440000e-129 472
22 TraesCS7B01G435100 chr7A 91.369 336 28 1 1 336 703034365 703034031 4.240000e-125 459
23 TraesCS7B01G435100 chrUn 91.514 1744 124 13 350 2083 335211277 335209548 0.000000e+00 2379
24 TraesCS7B01G435100 chrUn 93.103 1218 70 8 867 2083 355096430 355095226 0.000000e+00 1772
25 TraesCS7B01G435100 chrUn 92.025 953 54 11 2287 3233 335209606 335208670 0.000000e+00 1319
26 TraesCS7B01G435100 chrUn 92.025 953 54 11 2287 3233 355095284 355094348 0.000000e+00 1319
27 TraesCS7B01G435100 chrUn 88.587 736 46 6 3235 3935 83495926 83496658 0.000000e+00 859
28 TraesCS7B01G435100 chrUn 91.369 336 28 1 1 336 326307507 326307841 4.240000e-125 459
29 TraesCS7B01G435100 chr2A 95.122 164 8 0 2126 2289 662973480 662973643 4.610000e-65 259
30 TraesCS7B01G435100 chr2A 95.122 164 8 0 2126 2289 663305252 663305415 4.610000e-65 259
31 TraesCS7B01G435100 chr5A 93.452 168 9 1 2123 2290 529087256 529087091 9.980000e-62 248
32 TraesCS7B01G435100 chr3D 93.023 172 8 3 2126 2297 410670224 410670057 9.980000e-62 248
33 TraesCS7B01G435100 chr1B 92.941 170 9 2 2125 2294 450130780 450130946 1.290000e-60 244
34 TraesCS7B01G435100 chr5D 81.159 207 28 11 2121 2324 17813174 17813372 6.220000e-34 156


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G435100 chr7B 701990225 701994870 4645 True 8580.000000 8580 100.000000 1 4646 1 chr7B.!!$R3 4645
1 TraesCS7B01G435100 chr7B 701934028 701938674 4646 True 8469.000000 8469 99.570000 1 4646 1 chr7B.!!$R2 4645
2 TraesCS7B01G435100 chr7B 702058287 702063408 5121 True 3838.500000 5158 96.062500 1 4646 2 chr7B.!!$R6 4645
3 TraesCS7B01G435100 chr7B 701901513 701905904 4391 True 2848.000000 2922 90.401500 1 4646 2 chr7B.!!$R4 4645
4 TraesCS7B01G435100 chr7B 702151466 702156679 5213 True 2472.666667 3020 95.273667 1 4646 3 chr7B.!!$R7 4645
5 TraesCS7B01G435100 chr7B 701921571 701923688 2117 True 1940.000000 1940 83.671000 2394 4506 1 chr7B.!!$R1 2112
6 TraesCS7B01G435100 chr7B 702046008 702049390 3382 True 1594.500000 1899 85.557500 963 4506 2 chr7B.!!$R5 3543
7 TraesCS7B01G435100 chr7D 612514019 612520021 6002 True 1735.500000 3097 91.027000 1 4646 4 chr7D.!!$R4 4645
8 TraesCS7B01G435100 chr7D 612492845 612494426 1581 True 1578.000000 1578 85.208000 2401 3955 1 chr7D.!!$R2 1554
9 TraesCS7B01G435100 chr7D 612505036 612506619 1583 True 1563.000000 1563 85.040000 2401 3955 1 chr7D.!!$R3 1554
10 TraesCS7B01G435100 chr7A 702996505 703000958 4453 True 1947.333333 3035 90.928667 1 4646 3 chr7A.!!$R2 4645
11 TraesCS7B01G435100 chrUn 335208670 335211277 2607 True 1849.000000 2379 91.769500 350 3233 2 chrUn.!!$R1 2883
12 TraesCS7B01G435100 chrUn 355094348 355096430 2082 True 1545.500000 1772 92.564000 867 3233 2 chrUn.!!$R2 2366
13 TraesCS7B01G435100 chrUn 83495926 83496658 732 False 859.000000 859 88.587000 3235 3935 1 chrUn.!!$F1 700

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
806 912 8.443979 AGCCTTCATTTATTATCTAAAGCCTCT 58.556 33.333 0.00 0.0 0.00 3.69 F
1510 3163 3.692406 GGAACCTCGTCCGGCTGT 61.692 66.667 0.00 0.0 0.00 4.40 F
1950 3603 0.398318 GGAGCCTCCAGAAGTTGTGT 59.602 55.000 5.69 0.0 36.28 3.72 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1950 3603 4.020573 CCCTGTGTATTTCCTGTGTGTAGA 60.021 45.833 0.0 0.0 0.00 2.59 R
3292 5594 4.649088 AAGGAAGCCTACACACAAAAAC 57.351 40.909 0.0 0.0 31.13 2.43 R
3651 5967 3.358111 TGAATCCGCCAATGTAAGGAA 57.642 42.857 0.0 0.0 36.25 3.36 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
806 912 8.443979 AGCCTTCATTTATTATCTAAAGCCTCT 58.556 33.333 0.00 0.0 0.00 3.69
1510 3163 3.692406 GGAACCTCGTCCGGCTGT 61.692 66.667 0.00 0.0 0.00 4.40
1950 3603 0.398318 GGAGCCTCCAGAAGTTGTGT 59.602 55.000 5.69 0.0 36.28 3.72
3148 5441 5.105917 GGTGGTTGAAATGTGGTAGTATTGG 60.106 44.000 0.00 0.0 0.00 3.16
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
806 912 4.650734 TCTGGTGCAAAACATACTCATCA 58.349 39.130 0.0 0.0 0.00 3.07
1950 3603 4.020573 CCCTGTGTATTTCCTGTGTGTAGA 60.021 45.833 0.0 0.0 0.00 2.59
3148 5441 6.555315 CACAACTAAACTCTAATTGGGATGC 58.445 40.000 0.0 0.0 0.00 3.91
3292 5594 4.649088 AAGGAAGCCTACACACAAAAAC 57.351 40.909 0.0 0.0 31.13 2.43
3651 5967 3.358111 TGAATCCGCCAATGTAAGGAA 57.642 42.857 0.0 0.0 36.25 3.36
4019 6364 4.720046 TGGTTAATAAGTGACAAGTGGCA 58.280 39.130 0.0 0.0 0.00 4.92
4268 6628 1.324383 TCCCCTTTCGTTCCTTTTGC 58.676 50.000 0.0 0.0 0.00 3.68


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.