Multiple sequence alignment - TraesCS7B01G435000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G435000 chr7B 100.000 3729 0 0 1 3729 701938673 701934945 0.000000e+00 6887
1 TraesCS7B01G435000 chr7B 99.625 3730 11 3 1 3729 701994869 701991142 0.000000e+00 6807
2 TraesCS7B01G435000 chr7B 97.382 3056 56 9 4 3057 702063404 702060371 0.000000e+00 5179
3 TraesCS7B01G435000 chr7B 98.372 1720 26 2 1339 3057 702155268 702153550 0.000000e+00 3020
4 TraesCS7B01G435000 chr7B 91.117 2094 130 21 1 2055 701905903 701903827 0.000000e+00 2785
5 TraesCS7B01G435000 chr7B 91.953 1367 87 14 2371 3723 701903829 701902472 0.000000e+00 1893
6 TraesCS7B01G435000 chr7B 92.487 1331 72 9 1 1307 702156678 702155352 0.000000e+00 1879
7 TraesCS7B01G435000 chr7B 85.944 1366 138 29 2394 3729 701923688 701922347 0.000000e+00 1410
8 TraesCS7B01G435000 chr7B 85.735 1367 140 28 2394 3729 702141114 702139772 0.000000e+00 1393
9 TraesCS7B01G435000 chr7B 85.589 1367 142 28 2394 3729 702048128 702046786 0.000000e+00 1382
10 TraesCS7B01G435000 chr7B 87.925 1118 112 12 963 2074 702049390 702048290 0.000000e+00 1295
11 TraesCS7B01G435000 chr7B 96.210 686 21 4 3044 3729 702059910 702059230 0.000000e+00 1118
12 TraesCS7B01G435000 chr7B 96.064 686 23 3 3044 3729 702153090 702152409 0.000000e+00 1114
13 TraesCS7B01G435000 chrUn 91.571 1744 123 13 350 2083 335211277 335209548 0.000000e+00 2385
14 TraesCS7B01G435000 chrUn 93.103 1218 70 8 867 2083 355096430 355095226 0.000000e+00 1772
15 TraesCS7B01G435000 chrUn 91.920 953 54 12 2287 3232 335209606 335208670 0.000000e+00 1312
16 TraesCS7B01G435000 chrUn 91.920 953 54 12 2287 3232 355095284 355094348 0.000000e+00 1312
17 TraesCS7B01G435000 chrUn 91.182 499 31 6 3234 3723 83495926 83496420 0.000000e+00 665
18 TraesCS7B01G435000 chrUn 91.071 336 28 2 1 336 326307508 326307841 1.580000e-123 453
19 TraesCS7B01G435000 chr7A 91.022 1771 118 19 326 2083 703000566 702998824 0.000000e+00 2351
20 TraesCS7B01G435000 chr7A 90.953 1459 95 18 2287 3729 702998882 702997445 0.000000e+00 1929
21 TraesCS7B01G435000 chr7A 91.716 338 23 4 1 337 703000957 703000624 7.290000e-127 464
22 TraesCS7B01G435000 chr7A 91.071 336 28 2 1 336 703034364 703034031 1.580000e-123 453
23 TraesCS7B01G435000 chr7D 91.134 1658 106 20 471 2109 612518055 612516420 0.000000e+00 2209
24 TraesCS7B01G435000 chr7D 91.319 1463 90 22 2288 3729 612516405 612514959 0.000000e+00 1964
25 TraesCS7B01G435000 chr7D 90.716 894 65 9 327 1210 612519662 612518777 0.000000e+00 1175
26 TraesCS7B01G435000 chr7D 91.716 338 24 4 1 337 612520020 612519686 2.030000e-127 466
27 TraesCS7B01G435000 chr7D 93.413 167 10 1 2123 2289 235502571 235502406 2.880000e-61 246
28 TraesCS7B01G435000 chr2A 95.122 164 8 0 2126 2289 662973480 662973643 3.690000e-65 259
29 TraesCS7B01G435000 chr2A 95.122 164 8 0 2126 2289 663305252 663305415 3.690000e-65 259
30 TraesCS7B01G435000 chr5A 93.452 168 9 1 2123 2290 529087256 529087091 8.000000e-62 248
31 TraesCS7B01G435000 chr3D 93.023 172 8 3 2126 2297 410670224 410670057 8.000000e-62 248
32 TraesCS7B01G435000 chr1B 92.941 170 9 2 2125 2294 450130780 450130946 1.030000e-60 244


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G435000 chr7B 701934945 701938673 3728 True 6887.000000 6887 100.000000 1 3729 1 chr7B.!!$R2 3728
1 TraesCS7B01G435000 chr7B 701991142 701994869 3727 True 6807.000000 6807 99.625000 1 3729 1 chr7B.!!$R3 3728
2 TraesCS7B01G435000 chr7B 702059230 702063404 4174 True 3148.500000 5179 96.796000 4 3729 2 chr7B.!!$R7 3725
3 TraesCS7B01G435000 chr7B 701902472 701905903 3431 True 2339.000000 2785 91.535000 1 3723 2 chr7B.!!$R5 3722
4 TraesCS7B01G435000 chr7B 702152409 702156678 4269 True 2004.333333 3020 95.641000 1 3729 3 chr7B.!!$R8 3728
5 TraesCS7B01G435000 chr7B 701922347 701923688 1341 True 1410.000000 1410 85.944000 2394 3729 1 chr7B.!!$R1 1335
6 TraesCS7B01G435000 chr7B 702139772 702141114 1342 True 1393.000000 1393 85.735000 2394 3729 1 chr7B.!!$R4 1335
7 TraesCS7B01G435000 chr7B 702046786 702049390 2604 True 1338.500000 1382 86.757000 963 3729 2 chr7B.!!$R6 2766
8 TraesCS7B01G435000 chrUn 335208670 335211277 2607 True 1848.500000 2385 91.745500 350 3232 2 chrUn.!!$R1 2882
9 TraesCS7B01G435000 chrUn 355094348 355096430 2082 True 1542.000000 1772 92.511500 867 3232 2 chrUn.!!$R2 2365
10 TraesCS7B01G435000 chr7A 702997445 703000957 3512 True 1581.333333 2351 91.230333 1 3729 3 chr7A.!!$R2 3728
11 TraesCS7B01G435000 chr7D 612514959 612520020 5061 True 1453.500000 2209 91.221250 1 3729 4 chr7D.!!$R2 3728

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
950 2521 2.303175 CGGGGTTTCAGTTCCAAAAGA 58.697 47.619 0.0 0.0 0.00 2.52 F
2588 4351 3.282885 GTTTCATCTCCTTGGGATCACC 58.717 50.000 0.0 0.0 40.81 4.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2588 4351 6.127952 GCCTCTGTATACCTCTAGAAATACGG 60.128 46.154 15.79 15.79 34.08 4.02 R
3688 5970 6.018469 TGTTCAGAATGGGAAAAGGATGATT 58.982 36.000 0.00 0.00 36.16 2.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
950 2521 2.303175 CGGGGTTTCAGTTCCAAAAGA 58.697 47.619 0.0 0.0 0.00 2.52
2588 4351 3.282885 GTTTCATCTCCTTGGGATCACC 58.717 50.000 0.0 0.0 40.81 4.02
3687 5969 4.083324 GGATTCAAGTGCTCATCGACAAAA 60.083 41.667 0.0 0.0 0.00 2.44
3688 5970 4.891627 TTCAAGTGCTCATCGACAAAAA 57.108 36.364 0.0 0.0 0.00 1.94
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
950 2521 1.112916 CAAAGCCCACGGTTTTCCCT 61.113 55.000 0.00 0.00 37.60 4.20
2588 4351 6.127952 GCCTCTGTATACCTCTAGAAATACGG 60.128 46.154 15.79 15.79 34.08 4.02
3687 5969 6.497954 TGTTCAGAATGGGAAAAGGATGATTT 59.502 34.615 0.00 0.00 36.16 2.17
3688 5970 6.018469 TGTTCAGAATGGGAAAAGGATGATT 58.982 36.000 0.00 0.00 36.16 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.