Multiple sequence alignment - TraesCS7B01G430300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G430300 chr7B 100.000 6073 0 0 1 6073 698932998 698939070 0.000000e+00 11178.0
1 TraesCS7B01G430300 chr7B 99.521 3546 14 3 2531 6073 693399056 693402601 0.000000e+00 6451.0
2 TraesCS7B01G430300 chr7B 99.683 2521 7 1 1 2520 693396297 693398817 0.000000e+00 4610.0
3 TraesCS7B01G430300 chr7B 87.342 1825 213 13 3221 5040 697076532 697078343 0.000000e+00 2074.0
4 TraesCS7B01G430300 chr7B 91.879 1416 95 11 867 2266 697074773 697076184 0.000000e+00 1960.0
5 TraesCS7B01G430300 chr7B 83.504 1467 219 17 3590 5045 697077687 697079141 0.000000e+00 1347.0
6 TraesCS7B01G430300 chr7B 83.288 1460 227 11 3596 5046 695741438 695739987 0.000000e+00 1328.0
7 TraesCS7B01G430300 chr7B 81.350 1689 259 35 3590 5255 697080053 697081708 0.000000e+00 1323.0
8 TraesCS7B01G430300 chr7B 80.794 1562 260 28 3596 5141 695739071 695737534 0.000000e+00 1186.0
9 TraesCS7B01G430300 chr7B 80.046 1313 202 39 1016 2295 697241454 697240169 0.000000e+00 918.0
10 TraesCS7B01G430300 chr7B 89.496 714 58 8 873 1574 695761156 695760448 0.000000e+00 887.0
11 TraesCS7B01G430300 chr7B 91.415 629 41 8 1570 2195 695748437 695747819 0.000000e+00 850.0
12 TraesCS7B01G430300 chr7B 93.462 413 24 3 2814 3223 13257884 13257472 1.450000e-170 610.0
13 TraesCS7B01G430300 chr7B 89.320 103 11 0 5863 5965 262045939 262045837 4.940000e-26 130.0
14 TraesCS7B01G430300 chr7B 100.000 31 0 0 188 218 693396417 693396447 2.360000e-04 58.4
15 TraesCS7B01G430300 chr7B 100.000 31 0 0 121 151 693396484 693396514 2.360000e-04 58.4
16 TraesCS7B01G430300 chr7B 100.000 31 0 0 188 218 698933118 698933148 2.360000e-04 58.4
17 TraesCS7B01G430300 chr7B 100.000 31 0 0 121 151 698933185 698933215 2.360000e-04 58.4
18 TraesCS7B01G430300 chr7D 91.549 1633 107 13 863 2469 607955255 607953628 0.000000e+00 2222.0
19 TraesCS7B01G430300 chr7D 88.592 1832 194 9 3221 5048 607952960 607951140 0.000000e+00 2211.0
20 TraesCS7B01G430300 chr7D 84.153 1464 213 14 3596 5048 607951007 607949552 0.000000e+00 1400.0
21 TraesCS7B01G430300 chr7D 83.856 1468 220 11 3590 5048 607951806 607950347 0.000000e+00 1382.0
22 TraesCS7B01G430300 chr7D 80.124 1776 299 36 3590 5350 481666 479930 0.000000e+00 1275.0
23 TraesCS7B01G430300 chr7D 79.618 1781 303 45 3596 5358 983063 981325 0.000000e+00 1223.0
24 TraesCS7B01G430300 chr7D 79.850 1201 198 33 1146 2315 608812479 608811292 0.000000e+00 837.0
25 TraesCS7B01G430300 chr1A 93.947 413 20 3 2813 3220 27328799 27328387 2.400000e-173 619.0
26 TraesCS7B01G430300 chr1A 85.795 176 15 5 5790 5964 259054427 259054261 1.740000e-40 178.0
27 TraesCS7B01G430300 chr7A 93.689 412 20 4 2815 3220 640496593 640497004 4.020000e-171 612.0
28 TraesCS7B01G430300 chr7A 93.285 417 21 4 2810 3220 558102220 558102635 5.200000e-170 608.0
29 TraesCS7B01G430300 chr5B 93.888 409 20 3 2815 3220 648258637 648258231 4.020000e-171 612.0
30 TraesCS7B01G430300 chr4D 93.857 407 24 1 2815 3221 495973347 495973752 4.020000e-171 612.0
31 TraesCS7B01G430300 chr4D 90.291 103 8 2 5863 5965 214766715 214766615 3.820000e-27 134.0
32 TraesCS7B01G430300 chr3B 94.307 404 16 4 2817 3220 13402162 13402558 4.020000e-171 612.0
33 TraesCS7B01G430300 chr2A 93.301 418 21 5 2809 3221 61475553 61475968 1.450000e-170 610.0
34 TraesCS7B01G430300 chr1D 85.795 176 15 5 5790 5964 204036514 204036348 1.740000e-40 178.0
35 TraesCS7B01G430300 chr1B 87.261 157 9 8 5810 5965 173421773 173421919 1.050000e-37 169.0
36 TraesCS7B01G430300 chr2B 83.516 182 15 11 5784 5964 275322716 275322883 8.150000e-34 156.0
37 TraesCS7B01G430300 chr6B 83.523 176 15 11 5790 5964 452412650 452412488 1.050000e-32 152.0
38 TraesCS7B01G430300 chr5D 90.291 103 8 2 5863 5965 114384559 114384459 3.820000e-27 134.0
39 TraesCS7B01G430300 chr4A 88.393 112 12 1 5741 5852 726731074 726731184 3.820000e-27 134.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G430300 chr7B 698932998 698939070 6072 False 11178.00 11178 100.00000 1 6073 1 chr7B.!!$F1 6072
1 TraesCS7B01G430300 chr7B 693396297 693402601 6304 False 2794.45 6451 99.80100 1 6073 4 chr7B.!!$F2 6072
2 TraesCS7B01G430300 chr7B 697074773 697081708 6935 False 1676.00 2074 86.01875 867 5255 4 chr7B.!!$F3 4388
3 TraesCS7B01G430300 chr7B 695737534 695741438 3904 True 1257.00 1328 82.04100 3596 5141 2 chr7B.!!$R6 1545
4 TraesCS7B01G430300 chr7B 697240169 697241454 1285 True 918.00 918 80.04600 1016 2295 1 chr7B.!!$R5 1279
5 TraesCS7B01G430300 chr7B 695760448 695761156 708 True 887.00 887 89.49600 873 1574 1 chr7B.!!$R4 701
6 TraesCS7B01G430300 chr7B 695747819 695748437 618 True 850.00 850 91.41500 1570 2195 1 chr7B.!!$R3 625
7 TraesCS7B01G430300 chr7D 607949552 607955255 5703 True 1803.75 2222 87.03750 863 5048 4 chr7D.!!$R4 4185
8 TraesCS7B01G430300 chr7D 479930 481666 1736 True 1275.00 1275 80.12400 3590 5350 1 chr7D.!!$R1 1760
9 TraesCS7B01G430300 chr7D 981325 983063 1738 True 1223.00 1223 79.61800 3596 5358 1 chr7D.!!$R2 1762
10 TraesCS7B01G430300 chr7D 608811292 608812479 1187 True 837.00 837 79.85000 1146 2315 1 chr7D.!!$R3 1169

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
65 66 2.023414 AAGGTCGTCGTGCCTTGACA 62.023 55.000 18.12 0.0 42.9 3.58 F
82 83 3.849911 TGACATCGTGAAGGAATCTGAC 58.150 45.455 0.00 0.0 0.0 3.51 F
3206 3660 5.438761 GGTGCATATACAACCAAGAATCC 57.561 43.478 0.00 0.0 0.0 3.01 F
3211 3665 7.282224 GTGCATATACAACCAAGAATCCAAGTA 59.718 37.037 0.00 0.0 0.0 2.24 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2576 3018 5.011329 TCCTTTTAGAGGTTGAAGCTTACGA 59.989 40.000 0.00 0.00 46.39 3.43 R
3211 3665 1.697982 GTGTAGGAGCCCGGGAAATAT 59.302 52.381 29.31 7.88 0.00 1.28 R
4444 8869 0.909610 CCAGGCTGGGGTTGAGTCTA 60.910 60.000 26.34 0.00 32.67 2.59 R
5698 10941 1.319541 CCTCTTCCCGATTCGAGCTA 58.680 55.000 7.83 0.00 0.00 3.32 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
65 66 2.023414 AAGGTCGTCGTGCCTTGACA 62.023 55.000 18.12 0.0 42.90 3.58
82 83 3.849911 TGACATCGTGAAGGAATCTGAC 58.150 45.455 0.00 0.0 0.00 3.51
3206 3660 5.438761 GGTGCATATACAACCAAGAATCC 57.561 43.478 0.00 0.0 0.00 3.01
3211 3665 7.282224 GTGCATATACAACCAAGAATCCAAGTA 59.718 37.037 0.00 0.0 0.00 2.24
4061 4515 9.278978 ACGCATATAACCATGTATGTATCAAAA 57.721 29.630 0.00 0.0 34.22 2.44
4444 8869 2.158559 TGTGTACGCCTTTGATTGCAT 58.841 42.857 3.51 0.0 0.00 3.96
5598 10841 4.838152 GAAGATCGCGGGGCAGCA 62.838 66.667 6.13 0.0 36.85 4.41
5698 10941 2.919856 ACCAGCAGCGACAGGAGT 60.920 61.111 3.65 0.0 0.00 3.85
5735 10978 3.928779 TGGATGGATCGGAGCGGC 61.929 66.667 0.00 0.0 0.00 6.53
5792 11035 0.382158 CGCGAGTAGAGGATCAAGCA 59.618 55.000 0.00 0.0 37.82 3.91
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
65 66 3.261897 ACAAGGTCAGATTCCTTCACGAT 59.738 43.478 0.00 0.00 42.57 3.73
82 83 3.821033 CCCCTCTAAACACTTTGACAAGG 59.179 47.826 0.00 0.00 33.82 3.61
2576 3018 5.011329 TCCTTTTAGAGGTTGAAGCTTACGA 59.989 40.000 0.00 0.00 46.39 3.43
3206 3660 2.372172 AGGAGCCCGGGAAATATACTTG 59.628 50.000 29.31 0.00 0.00 3.16
3211 3665 1.697982 GTGTAGGAGCCCGGGAAATAT 59.302 52.381 29.31 7.88 0.00 1.28
4444 8869 0.909610 CCAGGCTGGGGTTGAGTCTA 60.910 60.000 26.34 0.00 32.67 2.59
5598 10841 5.124776 CCTCTGATTGAGTCGTACTTCTTCT 59.875 44.000 0.00 0.00 41.11 2.85
5698 10941 1.319541 CCTCTTCCCGATTCGAGCTA 58.680 55.000 7.83 0.00 0.00 3.32
5735 10978 2.551270 GCTGTCGCTGTTTCACCG 59.449 61.111 0.00 0.00 0.00 4.94
5792 11035 1.769733 TTTTAGTACGCGCAACTCGT 58.230 45.000 16.96 2.87 43.20 4.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.