Multiple sequence alignment - TraesCS7B01G429500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G429500 chr7B 100.000 2300 0 0 1 2300 698144693 698142394 0 4248
1 TraesCS7B01G429500 chr1B 99.478 2300 12 0 1 2300 683729610 683731909 0 4181
2 TraesCS7B01G429500 chr6B 99.130 2300 20 0 1 2300 128916648 128914349 0 4137
3 TraesCS7B01G429500 chr3B 99.087 2300 21 0 1 2300 92266388 92264089 0 4132
4 TraesCS7B01G429500 chr3B 98.957 2301 23 1 1 2300 5082608 5084908 0 4115
5 TraesCS7B01G429500 chr2A 99.043 2300 22 0 1 2300 563261173 563258874 0 4126
6 TraesCS7B01G429500 chr2A 98.653 2301 30 1 1 2300 735141324 735139024 0 4076
7 TraesCS7B01G429500 chr5B 98.827 2301 25 2 1 2300 713077687 713079986 0 4098
8 TraesCS7B01G429500 chr5B 98.480 2302 33 2 1 2300 713131028 713128727 0 4056


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G429500 chr7B 698142394 698144693 2299 True 4248 4248 100.000 1 2300 1 chr7B.!!$R1 2299
1 TraesCS7B01G429500 chr1B 683729610 683731909 2299 False 4181 4181 99.478 1 2300 1 chr1B.!!$F1 2299
2 TraesCS7B01G429500 chr6B 128914349 128916648 2299 True 4137 4137 99.130 1 2300 1 chr6B.!!$R1 2299
3 TraesCS7B01G429500 chr3B 92264089 92266388 2299 True 4132 4132 99.087 1 2300 1 chr3B.!!$R1 2299
4 TraesCS7B01G429500 chr3B 5082608 5084908 2300 False 4115 4115 98.957 1 2300 1 chr3B.!!$F1 2299
5 TraesCS7B01G429500 chr2A 563258874 563261173 2299 True 4126 4126 99.043 1 2300 1 chr2A.!!$R1 2299
6 TraesCS7B01G429500 chr2A 735139024 735141324 2300 True 4076 4076 98.653 1 2300 1 chr2A.!!$R2 2299
7 TraesCS7B01G429500 chr5B 713077687 713079986 2299 False 4098 4098 98.827 1 2300 1 chr5B.!!$F1 2299
8 TraesCS7B01G429500 chr5B 713128727 713131028 2301 True 4056 4056 98.480 1 2300 1 chr5B.!!$R1 2299

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
587 589 0.179048 CATTGATGAGTGGGCGCCTA 60.179 55.0 28.56 19.98 0.0 3.93 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1854 1858 0.828762 TCAACTTCCCCGGTCTTCGA 60.829 55.0 0.0 0.0 42.43 3.71 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
320 321 6.147821 CCAGATTGTGTAGACACTTTAAGGTG 59.852 42.308 15.56 15.56 46.55 4.00
587 589 0.179048 CATTGATGAGTGGGCGCCTA 60.179 55.000 28.56 19.98 0.00 3.93
1378 1380 7.237471 TCCAGTTCCAATTGGAGCATATAGATA 59.763 37.037 34.32 13.04 46.37 1.98
1379 1381 8.051535 CCAGTTCCAATTGGAGCATATAGATAT 58.948 37.037 34.32 14.26 46.37 1.63
1520 1523 3.012518 CCACCGATGCAGAAAATCTTCT 58.987 45.455 0.00 0.00 42.96 2.85
1699 1703 1.668751 GAGACCTCGCAAACAACAACA 59.331 47.619 0.00 0.00 0.00 3.33
1854 1858 1.680522 CTGCCTCATACAGCTCGGGT 61.681 60.000 0.00 0.00 0.00 5.28
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
182 183 4.758674 CCATTGATAGGTGAATTGAGCGAT 59.241 41.667 0.00 0.00 0.00 4.58
587 589 1.815003 GAGCTTGGCTATTGTTGTGCT 59.185 47.619 0.00 0.00 39.88 4.40
1378 1380 9.806448 TGGCTATACATACAAATCCATTTACAT 57.194 29.630 0.00 0.00 0.00 2.29
1379 1381 9.062524 GTGGCTATACATACAAATCCATTTACA 57.937 33.333 0.00 0.00 0.00 2.41
1520 1523 6.899089 TGCCTCATATGAGAATGGAAAACTA 58.101 36.000 30.40 3.51 44.74 2.24
1699 1703 3.073062 CGAACTCCATATGGGGAAGGAAT 59.927 47.826 28.98 0.84 38.16 3.01
1854 1858 0.828762 TCAACTTCCCCGGTCTTCGA 60.829 55.000 0.00 0.00 42.43 3.71


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.