Multiple sequence alignment - TraesCS7B01G429400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G429400 chr7B 100.000 2630 0 0 1 2630 698140160 698142789 0 4857
1 TraesCS7B01G429400 chrUn 99.392 2631 15 1 1 2630 223706934 223704304 0 4769
2 TraesCS7B01G429400 chr2A 99.316 2631 16 2 1 2630 605912877 605910248 0 4758
3 TraesCS7B01G429400 chr2A 98.669 2630 33 1 1 2630 563256642 563259269 0 4662
4 TraesCS7B01G429400 chr1B 99.278 2630 18 1 1 2630 683734142 683731514 0 4750
5 TraesCS7B01G429400 chr1B 98.633 2633 33 3 1 2630 338892817 338895449 0 4660
6 TraesCS7B01G429400 chr5B 98.821 2630 28 2 1 2630 713082218 713079592 0 4682
7 TraesCS7B01G429400 chr3D 98.593 2630 29 4 1 2630 202649731 202652352 0 4645


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G429400 chr7B 698140160 698142789 2629 False 4857 4857 100.000 1 2630 1 chr7B.!!$F1 2629
1 TraesCS7B01G429400 chrUn 223704304 223706934 2630 True 4769 4769 99.392 1 2630 1 chrUn.!!$R1 2629
2 TraesCS7B01G429400 chr2A 605910248 605912877 2629 True 4758 4758 99.316 1 2630 1 chr2A.!!$R1 2629
3 TraesCS7B01G429400 chr2A 563256642 563259269 2627 False 4662 4662 98.669 1 2630 1 chr2A.!!$F1 2629
4 TraesCS7B01G429400 chr1B 683731514 683734142 2628 True 4750 4750 99.278 1 2630 1 chr1B.!!$R1 2629
5 TraesCS7B01G429400 chr1B 338892817 338895449 2632 False 4660 4660 98.633 1 2630 1 chr1B.!!$F1 2629
6 TraesCS7B01G429400 chr5B 713079592 713082218 2626 True 4682 4682 98.821 1 2630 1 chr5B.!!$R1 2629
7 TraesCS7B01G429400 chr3D 202649731 202652352 2621 False 4645 4645 98.593 1 2630 1 chr3D.!!$F1 2629

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
924 926 3.119637 CGGCAACATAGGTACCCTTTTTG 60.12 47.826 8.74 8.77 34.61 2.44 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2030 2033 0.94718 TAACGCCACTTCGCCAACTC 60.947 55.0 0.0 0.0 0.0 3.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
90 91 4.792521 ATATCGAGACCACAGCCTATTC 57.207 45.455 0.00 0.00 0.00 1.75
151 152 7.871853 TCTTCTCGATCGAACATATTGACATA 58.128 34.615 19.92 0.00 0.00 2.29
271 272 5.071788 TCACTCAGACCCTTTTGAATGTAGT 59.928 40.000 0.00 0.00 0.00 2.73
924 926 3.119637 CGGCAACATAGGTACCCTTTTTG 60.120 47.826 8.74 8.77 34.61 2.44
1417 1419 7.393796 TCTTTCGTACTCTCTTCTCTTTACCAT 59.606 37.037 0.00 0.00 0.00 3.55
1601 1604 0.317020 GTCGAGTGGTGCTTGTTTGC 60.317 55.000 0.00 0.00 0.00 3.68
1995 1998 0.320374 CTCGGAAACACCCAGTGCTA 59.680 55.000 0.00 0.00 36.98 3.49
2452 2456 8.597167 ACTGCACATATTAGATTCTATTAGCCA 58.403 33.333 0.00 0.00 0.00 4.75
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
90 91 2.884639 ACGGATCCTTTGTGGTTTGAAG 59.115 45.455 10.75 0.0 37.07 3.02
151 152 3.756082 TGGCCATGGAAAGGAGTATTT 57.244 42.857 18.40 0.0 0.00 1.40
271 272 0.616371 CCCCACTCCGTTGTTATCCA 59.384 55.000 0.00 0.0 0.00 3.41
924 926 1.133869 GTGTTCGCAACGCATACCC 59.866 57.895 7.43 0.0 41.43 3.69
1417 1419 1.226974 GCTTCGCTGACCTATCGCA 60.227 57.895 0.00 0.0 0.00 5.10
1995 1998 1.399714 TCGTGTCTCTCAGTGTGGTT 58.600 50.000 0.00 0.0 0.00 3.67
2030 2033 0.947180 TAACGCCACTTCGCCAACTC 60.947 55.000 0.00 0.0 0.00 3.01
2452 2456 1.424638 CAGTCCATTCCGGGATAGGT 58.575 55.000 0.00 0.0 39.62 3.08


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.