Multiple sequence alignment - TraesCS7B01G429100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G429100 chr7B 100.000 2342 0 0 1 2342 698126733 698124392 0 4325
1 TraesCS7B01G429100 chr7B 98.848 2343 26 1 1 2342 716795638 716793296 0 4176
2 TraesCS7B01G429100 chr7B 98.762 2343 24 3 1 2342 742937682 742940020 0 4161
3 TraesCS7B01G429100 chrUn 99.274 2343 16 1 1 2342 233525068 233522726 0 4231
4 TraesCS7B01G429100 chrUn 99.106 2348 15 2 1 2342 257944312 257946659 0 4215
5 TraesCS7B01G429100 chr7A 99.104 2343 20 1 1 2342 60095998 60093656 0 4209
6 TraesCS7B01G429100 chr1D 98.893 2348 20 2 1 2342 212429069 212431416 0 4187
7 TraesCS7B01G429100 chr6B 98.720 2343 29 1 1 2342 128889783 128887441 0 4159
8 TraesCS7B01G429100 chr5B 98.592 2343 32 1 1 2342 713112763 713110421 0 4143
9 TraesCS7B01G429100 chr2B 97.998 2348 41 2 1 2342 357190631 357188284 0 4071


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G429100 chr7B 698124392 698126733 2341 True 4325 4325 100.000 1 2342 1 chr7B.!!$R1 2341
1 TraesCS7B01G429100 chr7B 716793296 716795638 2342 True 4176 4176 98.848 1 2342 1 chr7B.!!$R2 2341
2 TraesCS7B01G429100 chr7B 742937682 742940020 2338 False 4161 4161 98.762 1 2342 1 chr7B.!!$F1 2341
3 TraesCS7B01G429100 chrUn 233522726 233525068 2342 True 4231 4231 99.274 1 2342 1 chrUn.!!$R1 2341
4 TraesCS7B01G429100 chrUn 257944312 257946659 2347 False 4215 4215 99.106 1 2342 1 chrUn.!!$F1 2341
5 TraesCS7B01G429100 chr7A 60093656 60095998 2342 True 4209 4209 99.104 1 2342 1 chr7A.!!$R1 2341
6 TraesCS7B01G429100 chr1D 212429069 212431416 2347 False 4187 4187 98.893 1 2342 1 chr1D.!!$F1 2341
7 TraesCS7B01G429100 chr6B 128887441 128889783 2342 True 4159 4159 98.720 1 2342 1 chr6B.!!$R1 2341
8 TraesCS7B01G429100 chr5B 713110421 713112763 2342 True 4143 4143 98.592 1 2342 1 chr5B.!!$R1 2341
9 TraesCS7B01G429100 chr2B 357188284 357190631 2347 True 4071 4071 97.998 1 2342 1 chr2B.!!$R1 2341

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
400 401 2.804697 TCGTTCGATGTCTTGAACCA 57.195 45.0 0.0 0.0 41.12 3.67 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1595 1601 1.380515 TTGCCTCCCTCTCTCCTCG 60.381 63.158 0.0 0.0 0.0 4.63 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
400 401 2.804697 TCGTTCGATGTCTTGAACCA 57.195 45.000 0.00 0.0 41.12 3.67
405 406 4.090066 CGTTCGATGTCTTGAACCACTTAG 59.910 45.833 0.00 0.0 41.12 2.18
1095 1101 2.360852 CCAGGGCCAGAGCAAGTG 60.361 66.667 6.18 0.0 42.56 3.16
1595 1601 4.600207 GGACGAGCTCCAAGGAAC 57.400 61.111 8.47 0.0 39.21 3.62
1971 1977 5.997384 ACCGGGACCTATTCTCATAATAC 57.003 43.478 6.32 0.0 0.00 1.89
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
170 171 5.039920 TCCATCTTGATGACGAATTCCAT 57.960 39.130 11.76 0.0 0.00 3.41
1095 1101 1.765597 CGGCTCTATACCCCAACCCC 61.766 65.000 0.00 0.0 0.00 4.95
1594 1600 2.156496 TTGCCTCCCTCTCTCCTCGT 62.156 60.000 0.00 0.0 0.00 4.18
1595 1601 1.380515 TTGCCTCCCTCTCTCCTCG 60.381 63.158 0.00 0.0 0.00 4.63
1971 1977 1.986698 ATTTAGCTTTGCTTGCTGCG 58.013 45.000 0.00 0.0 46.63 5.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.