Multiple sequence alignment - TraesCS7B01G425600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G425600 chr7B 100.000 3854 0 0 1 3854 694365153 694361300 0.000000e+00 7118
1 TraesCS7B01G425600 chr7B 96.415 3710 54 19 1 3637 698655861 698652158 0.000000e+00 6041
2 TraesCS7B01G425600 chr7B 96.458 3444 55 18 1 3383 699146171 699142734 0.000000e+00 5622
3 TraesCS7B01G425600 chr7B 90.897 2889 189 40 162 3027 696145887 696143050 0.000000e+00 3810
4 TraesCS7B01G425600 chr7B 90.912 2751 151 30 936 3637 699141479 699138779 0.000000e+00 3603
5 TraesCS7B01G425600 chr7B 90.646 2630 159 33 738 3332 699182593 699180016 0.000000e+00 3413
6 TraesCS7B01G425600 chr7B 92.009 1777 85 20 1892 3637 693621424 693619674 0.000000e+00 2442
7 TraesCS7B01G425600 chr7B 87.353 1273 113 26 523 1772 693314804 693316051 0.000000e+00 1415
8 TraesCS7B01G425600 chr7B 84.424 1085 121 31 433 1508 697024502 697025547 0.000000e+00 1024
9 TraesCS7B01G425600 chr7B 82.690 855 93 17 3023 3854 696142881 696142059 0.000000e+00 708
10 TraesCS7B01G425600 chr7B 84.240 717 60 19 194 888 694189286 694189971 0.000000e+00 649
11 TraesCS7B01G425600 chr7B 91.554 296 21 4 194 486 693313254 693313548 4.640000e-109 405
12 TraesCS7B01G425600 chr7B 98.214 224 4 0 3631 3854 693619637 693619414 3.610000e-105 392
13 TraesCS7B01G425600 chr7B 98.214 224 4 0 3631 3854 698652121 698651898 3.610000e-105 392
14 TraesCS7B01G425600 chr7B 90.625 224 19 1 3631 3854 699138742 699138521 2.910000e-76 296
15 TraesCS7B01G425600 chr7B 90.625 224 15 4 3631 3854 699179623 699179406 3.770000e-75 292
16 TraesCS7B01G425600 chr7B 88.115 244 25 3 169 409 697024262 697024504 1.750000e-73 287
17 TraesCS7B01G425600 chr7B 90.741 162 14 1 3391 3552 699180021 699179861 8.390000e-52 215
18 TraesCS7B01G425600 chr7D 89.315 3341 217 60 194 3492 608199850 608196608 0.000000e+00 4063
19 TraesCS7B01G425600 chr7D 86.941 2994 251 73 42 2945 514750465 514747522 0.000000e+00 3234
20 TraesCS7B01G425600 chr7D 83.052 1894 215 70 185 2005 600232202 600234062 0.000000e+00 1622
21 TraesCS7B01G425600 chr7D 91.536 1087 77 9 833 1910 610532295 610533375 0.000000e+00 1483
22 TraesCS7B01G425600 chr7D 89.327 1040 80 20 2004 3027 610533556 610534580 0.000000e+00 1277
23 TraesCS7B01G425600 chr7D 83.041 1085 117 32 439 1508 609861941 609862973 0.000000e+00 922
24 TraesCS7B01G425600 chr7D 85.213 940 77 33 2943 3854 514747037 514746132 0.000000e+00 909
25 TraesCS7B01G425600 chr7D 85.332 859 77 22 3023 3854 610534742 610535578 0.000000e+00 843
26 TraesCS7B01G425600 chr7D 85.558 547 49 18 194 719 610531534 610532071 2.620000e-151 545
27 TraesCS7B01G425600 chr7D 86.694 481 48 11 3382 3854 600235612 600236084 1.590000e-143 520
28 TraesCS7B01G425600 chr7D 87.805 287 23 7 108 384 609348728 609348444 3.710000e-85 326
29 TraesCS7B01G425600 chr7D 93.684 95 4 2 6 100 610531397 610531489 1.440000e-29 141
30 TraesCS7B01G425600 chr7A 85.692 3159 290 79 162 3256 700503638 700506698 0.000000e+00 3181
31 TraesCS7B01G425600 chr7A 88.389 1688 126 31 2004 3637 700208119 700206448 0.000000e+00 1967
32 TraesCS7B01G425600 chr7A 83.835 631 65 15 3256 3854 700506725 700507350 2.010000e-157 566
33 TraesCS7B01G425600 chr7A 91.518 224 19 0 3631 3854 700206411 700206188 3.740000e-80 309
34 TraesCS7B01G425600 chr7A 90.000 100 8 2 1 100 700503419 700503516 1.120000e-25 128
35 TraesCS7B01G425600 chr4A 91.989 1111 66 12 1696 2801 661823500 661822408 0.000000e+00 1537
36 TraesCS7B01G425600 chr4A 93.630 832 46 5 872 1698 661826027 661825198 0.000000e+00 1236
37 TraesCS7B01G425600 chr4A 85.086 818 55 21 2853 3637 661822411 661821628 0.000000e+00 773
38 TraesCS7B01G425600 chr4A 80.349 458 34 24 42 466 661826461 661826027 2.910000e-76 296
39 TraesCS7B01G425600 chrUn 83.041 1085 117 32 439 1508 209380917 209379885 0.000000e+00 922
40 TraesCS7B01G425600 chr4B 82.322 379 33 12 514 878 55721793 55721435 8.090000e-77 298


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G425600 chr7B 694361300 694365153 3853 True 7118.000000 7118 100.000000 1 3854 1 chr7B.!!$R1 3853
1 TraesCS7B01G425600 chr7B 698651898 698655861 3963 True 3216.500000 6041 97.314500 1 3854 2 chr7B.!!$R4 3853
2 TraesCS7B01G425600 chr7B 699138521 699146171 7650 True 3173.666667 5622 92.665000 1 3854 3 chr7B.!!$R5 3853
3 TraesCS7B01G425600 chr7B 696142059 696145887 3828 True 2259.000000 3810 86.793500 162 3854 2 chr7B.!!$R3 3692
4 TraesCS7B01G425600 chr7B 693619414 693621424 2010 True 1417.000000 2442 95.111500 1892 3854 2 chr7B.!!$R2 1962
5 TraesCS7B01G425600 chr7B 699179406 699182593 3187 True 1306.666667 3413 90.670667 738 3854 3 chr7B.!!$R6 3116
6 TraesCS7B01G425600 chr7B 693313254 693316051 2797 False 910.000000 1415 89.453500 194 1772 2 chr7B.!!$F2 1578
7 TraesCS7B01G425600 chr7B 697024262 697025547 1285 False 655.500000 1024 86.269500 169 1508 2 chr7B.!!$F3 1339
8 TraesCS7B01G425600 chr7B 694189286 694189971 685 False 649.000000 649 84.240000 194 888 1 chr7B.!!$F1 694
9 TraesCS7B01G425600 chr7D 608196608 608199850 3242 True 4063.000000 4063 89.315000 194 3492 1 chr7D.!!$R1 3298
10 TraesCS7B01G425600 chr7D 514746132 514750465 4333 True 2071.500000 3234 86.077000 42 3854 2 chr7D.!!$R3 3812
11 TraesCS7B01G425600 chr7D 600232202 600236084 3882 False 1071.000000 1622 84.873000 185 3854 2 chr7D.!!$F2 3669
12 TraesCS7B01G425600 chr7D 609861941 609862973 1032 False 922.000000 922 83.041000 439 1508 1 chr7D.!!$F1 1069
13 TraesCS7B01G425600 chr7D 610531397 610535578 4181 False 857.800000 1483 89.087400 6 3854 5 chr7D.!!$F3 3848
14 TraesCS7B01G425600 chr7A 700503419 700507350 3931 False 1291.666667 3181 86.509000 1 3854 3 chr7A.!!$F1 3853
15 TraesCS7B01G425600 chr7A 700206188 700208119 1931 True 1138.000000 1967 89.953500 2004 3854 2 chr7A.!!$R1 1850
16 TraesCS7B01G425600 chr4A 661821628 661826461 4833 True 960.500000 1537 87.763500 42 3637 4 chr4A.!!$R1 3595
17 TraesCS7B01G425600 chrUn 209379885 209380917 1032 True 922.000000 922 83.041000 439 1508 1 chrUn.!!$R1 1069

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
106 159 1.369692 CACCACCACCACGAGCTTA 59.630 57.895 0.0 0.0 0.0 3.09 F
1103 2682 1.556911 CTTCTACACATGTCCCAGGCT 59.443 52.381 0.0 0.0 0.0 4.58 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1224 2806 0.318441 TCCTGAACAGCTCGGTTCTG 59.682 55.000 15.6 14.57 45.74 3.02 R
3044 10823 2.005451 CGATGCCTGAACCTGAAGAAG 58.995 52.381 0.0 0.00 0.00 2.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
26 27 2.159517 CGAGTGCTGCCCATCTAAAAAC 60.160 50.000 0.00 0.00 0.00 2.43
35 36 4.081917 TGCCCATCTAAAAACGGAAAATCC 60.082 41.667 0.00 0.00 0.00 3.01
36 37 4.159693 GCCCATCTAAAAACGGAAAATCCT 59.840 41.667 0.00 0.00 33.30 3.24
40 41 6.072175 CCATCTAAAAACGGAAAATCCTGACA 60.072 38.462 0.00 0.00 33.30 3.58
106 159 1.369692 CACCACCACCACGAGCTTA 59.630 57.895 0.00 0.00 0.00 3.09
135 191 4.473444 AGCATTTCTTTCCTTCACTTCCA 58.527 39.130 0.00 0.00 0.00 3.53
264 346 4.096003 CTCCATCCCCCACGCGTT 62.096 66.667 10.22 0.00 0.00 4.84
570 1944 3.634397 TCAGTTTGGGGAGATGATGTC 57.366 47.619 0.00 0.00 0.00 3.06
679 2089 5.670485 TGCTGATATCCGTATTTCTGTTGT 58.330 37.500 0.00 0.00 0.00 3.32
926 2491 4.162320 AGGAGATGAAAACCGAGCAGAATA 59.838 41.667 0.00 0.00 0.00 1.75
952 2517 3.691049 TCAAAAACTGAGGTCTTTGCG 57.309 42.857 1.86 0.00 34.45 4.85
953 2518 3.013921 TCAAAAACTGAGGTCTTTGCGT 58.986 40.909 1.86 0.00 34.45 5.24
1103 2682 1.556911 CTTCTACACATGTCCCAGGCT 59.443 52.381 0.00 0.00 0.00 4.58
1224 2806 0.536006 ACAGTGAACTCAAGCCTGCC 60.536 55.000 0.00 0.00 0.00 4.85
1776 5070 2.917343 GCTTATTTTGAGCGTTTCCTGC 59.083 45.455 0.00 0.00 0.00 4.85
1817 5117 5.239306 TCTTGCAACATCCAACTCTAACAAG 59.761 40.000 0.00 0.00 33.76 3.16
2910 10020 9.937876 AGCCAGCCACGGTATATATATATATAT 57.062 33.333 22.83 22.83 38.90 0.86
3044 10823 6.333416 TGACTCTGATGAACAATAGTAGCAC 58.667 40.000 0.00 0.00 0.00 4.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
26 27 1.196808 CCGTTGTGTCAGGATTTTCCG 59.803 52.381 0.00 0.00 42.75 4.30
35 36 2.908073 GCCTTGCCCGTTGTGTCAG 61.908 63.158 0.00 0.00 0.00 3.51
36 37 2.904866 GCCTTGCCCGTTGTGTCA 60.905 61.111 0.00 0.00 0.00 3.58
359 458 0.179100 TGAGAATCAGCTAGTGGCGC 60.179 55.000 0.00 0.00 42.56 6.53
570 1944 1.025113 CAGTGCAGGCCATGACTCAG 61.025 60.000 5.01 0.00 0.00 3.35
679 2089 5.005740 GCCAATCATCCTATGCATGTAAGA 58.994 41.667 10.16 0.68 0.00 2.10
926 2491 6.313658 GCAAAGACCTCAGTTTTTGAAACATT 59.686 34.615 11.94 0.00 46.08 2.71
952 2517 1.533625 TCATAGCAAACAGGGCACAC 58.466 50.000 0.00 0.00 0.00 3.82
953 2518 1.885887 GTTCATAGCAAACAGGGCACA 59.114 47.619 0.00 0.00 0.00 4.57
1103 2682 2.812836 TCCGGACCTATATATCGCCA 57.187 50.000 0.00 0.00 0.00 5.69
1224 2806 0.318441 TCCTGAACAGCTCGGTTCTG 59.682 55.000 15.60 14.57 45.74 3.02
1776 5070 4.142622 TGCAAGACATATTTTCAAGCCTCG 60.143 41.667 0.00 0.00 0.00 4.63
3044 10823 2.005451 CGATGCCTGAACCTGAAGAAG 58.995 52.381 0.00 0.00 0.00 2.85
3633 11642 4.543590 ACAGTGCTGTAGTTAGCTTGAT 57.456 40.909 2.62 0.00 42.90 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.