Multiple sequence alignment - TraesCS7B01G424600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G424600 chr7B 100.000 4411 0 0 1 4411 693438767 693443177 0.000000e+00 8146
1 TraesCS7B01G424600 chr7B 99.207 4412 29 3 1 4411 698973450 698977856 0.000000e+00 7949
2 TraesCS7B01G424600 chr7B 93.980 2741 108 22 1 2726 694825664 694822966 0.000000e+00 4095
3 TraesCS7B01G424600 chr7B 93.411 2747 148 16 1 2725 695262927 695260192 0.000000e+00 4039
4 TraesCS7B01G424600 chr7B 92.833 2623 160 7 1 2609 698502786 698505394 0.000000e+00 3777
5 TraesCS7B01G424600 chr7B 97.246 1380 23 3 2723 4101 694822939 694821574 0.000000e+00 2324
6 TraesCS7B01G424600 chr7B 91.488 1633 135 2 981 2609 684982522 684980890 0.000000e+00 2242
7 TraesCS7B01G424600 chr7B 91.249 1097 92 2 1517 2609 697385641 697384545 0.000000e+00 1491
8 TraesCS7B01G424600 chr7B 91.956 547 44 0 981 1527 697394510 697393964 0.000000e+00 767
9 TraesCS7B01G424600 chr7B 83.915 802 72 33 3176 3944 695259941 695259164 0.000000e+00 713
10 TraesCS7B01G424600 chr7B 83.501 794 84 24 3178 3941 699160029 699160805 0.000000e+00 697
11 TraesCS7B01G424600 chr7B 83.375 794 86 22 3178 3941 698506765 698507542 0.000000e+00 693
12 TraesCS7B01G424600 chr7B 89.095 431 37 2 2724 3149 697383734 697383309 1.090000e-145 527
13 TraesCS7B01G424600 chr7B 88.811 429 38 2 2724 3147 684980098 684979675 6.540000e-143 518
14 TraesCS7B01G424600 chr7B 88.345 429 42 4 2723 3149 698506352 698506774 3.940000e-140 508
15 TraesCS7B01G424600 chr7B 86.605 433 47 3 2723 3149 699159611 699160038 6.680000e-128 468
16 TraesCS7B01G424600 chr7B 91.667 132 7 2 2596 2726 699159456 699159584 3.510000e-41 180
17 TraesCS7B01G424600 chr7B 90.909 132 8 2 2596 2726 698506197 698506325 1.630000e-39 174
18 TraesCS7B01G424600 chr7D 90.444 2051 154 23 706 2725 610623711 610621672 0.000000e+00 2663
19 TraesCS7B01G424600 chr7D 91.590 1855 129 17 769 2609 608122529 608124370 0.000000e+00 2536
20 TraesCS7B01G424600 chr7D 90.925 1124 82 4 1444 2566 514346918 514345814 0.000000e+00 1493
21 TraesCS7B01G424600 chr7D 84.360 1266 134 27 2723 3944 514341950 514340705 0.000000e+00 1182
22 TraesCS7B01G424600 chr7D 84.048 1260 132 38 2723 3944 600273822 600272594 0.000000e+00 1149
23 TraesCS7B01G424600 chr7D 88.462 676 43 24 779 1453 514353626 514352985 0.000000e+00 784
24 TraesCS7B01G424600 chr7D 83.291 790 75 31 3194 3944 610614003 610613232 0.000000e+00 675
25 TraesCS7B01G424600 chr7D 87.192 609 50 17 3176 3776 514345363 514344775 0.000000e+00 667
26 TraesCS7B01G424600 chr7D 88.952 353 28 3 2723 3069 608125332 608125679 4.080000e-115 425
27 TraesCS7B01G424600 chr7D 90.000 230 20 3 410 637 572594240 572594468 1.200000e-75 294
28 TraesCS7B01G424600 chr7D 94.318 176 10 0 1 176 610623933 610623758 2.020000e-68 270
29 TraesCS7B01G424600 chr7D 92.486 173 13 0 1 173 608121064 608121236 9.470000e-62 248
30 TraesCS7B01G424600 chr7D 88.235 153 12 4 177 325 600280471 600280321 1.260000e-40 178
31 TraesCS7B01G424600 chr7D 90.152 132 9 2 2596 2726 610603489 610603361 7.590000e-38 169
32 TraesCS7B01G424600 chr7D 87.879 132 12 2 2596 2726 600273977 600273849 7.640000e-33 152
33 TraesCS7B01G424600 chr7A 86.725 2064 173 23 687 2720 700535575 700533583 0.000000e+00 2200
34 TraesCS7B01G424600 chr7A 81.943 803 79 28 3176 3944 700533039 700532269 1.740000e-173 619
35 TraesCS7B01G424600 chr2B 90.043 231 21 2 410 638 35130819 35131049 9.270000e-77 298
36 TraesCS7B01G424600 chr4A 89.610 231 22 2 410 638 655564580 655564350 4.320000e-75 292
37 TraesCS7B01G424600 chr4A 93.137 102 6 1 4002 4102 661700440 661700541 9.880000e-32 148
38 TraesCS7B01G424600 chr5D 89.224 232 23 2 410 639 533643391 533643160 5.580000e-74 289
39 TraesCS7B01G424600 chr4B 89.130 230 24 1 410 638 90868574 90868803 7.220000e-73 285


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G424600 chr7B 693438767 693443177 4410 False 8146.000000 8146 100.000000 1 4411 1 chr7B.!!$F1 4410
1 TraesCS7B01G424600 chr7B 698973450 698977856 4406 False 7949.000000 7949 99.207000 1 4411 1 chr7B.!!$F2 4410
2 TraesCS7B01G424600 chr7B 694821574 694825664 4090 True 3209.500000 4095 95.613000 1 4101 2 chr7B.!!$R3 4100
3 TraesCS7B01G424600 chr7B 695259164 695262927 3763 True 2376.000000 4039 88.663000 1 3944 2 chr7B.!!$R4 3943
4 TraesCS7B01G424600 chr7B 684979675 684982522 2847 True 1380.000000 2242 90.149500 981 3147 2 chr7B.!!$R2 2166
5 TraesCS7B01G424600 chr7B 698502786 698507542 4756 False 1288.000000 3777 88.865500 1 3941 4 chr7B.!!$F3 3940
6 TraesCS7B01G424600 chr7B 697383309 697385641 2332 True 1009.000000 1491 90.172000 1517 3149 2 chr7B.!!$R5 1632
7 TraesCS7B01G424600 chr7B 697393964 697394510 546 True 767.000000 767 91.956000 981 1527 1 chr7B.!!$R1 546
8 TraesCS7B01G424600 chr7B 699159456 699160805 1349 False 448.333333 697 87.257667 2596 3941 3 chr7B.!!$F4 1345
9 TraesCS7B01G424600 chr7D 610621672 610623933 2261 True 1466.500000 2663 92.381000 1 2725 2 chr7D.!!$R7 2724
10 TraesCS7B01G424600 chr7D 514340705 514346918 6213 True 1114.000000 1493 87.492333 1444 3944 3 chr7D.!!$R5 2500
11 TraesCS7B01G424600 chr7D 608121064 608125679 4615 False 1069.666667 2536 91.009333 1 3069 3 chr7D.!!$F2 3068
12 TraesCS7B01G424600 chr7D 514352985 514353626 641 True 784.000000 784 88.462000 779 1453 1 chr7D.!!$R1 674
13 TraesCS7B01G424600 chr7D 610613232 610614003 771 True 675.000000 675 83.291000 3194 3944 1 chr7D.!!$R4 750
14 TraesCS7B01G424600 chr7D 600272594 600273977 1383 True 650.500000 1149 85.963500 2596 3944 2 chr7D.!!$R6 1348
15 TraesCS7B01G424600 chr7A 700532269 700535575 3306 True 1409.500000 2200 84.334000 687 3944 2 chr7A.!!$R1 3257

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1574 2621 3.818787 CTCCGACCCCGTGTACCG 61.819 72.222 0.0 0.0 0.0 4.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
3800 8836 7.962964 TTCTCATGATTATACCGAAACCATC 57.037 36.0 0.0 0.0 0.0 3.51 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1574 2621 3.818787 CTCCGACCCCGTGTACCG 61.819 72.222 0.0 0.0 0.00 4.02
2922 7751 9.696917 GAAGAATTGAAAAAGCCATCTAGAAAA 57.303 29.630 0.0 0.0 0.00 2.29
3800 8836 2.347150 TGCAAACTATGACGCACATACG 59.653 45.455 0.0 0.0 40.07 3.06
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1332 2377 1.210155 GCAAAGCATGTCGGTCACC 59.790 57.895 0.0 0.0 0.0 4.02
3800 8836 7.962964 TTCTCATGATTATACCGAAACCATC 57.037 36.000 0.0 0.0 0.0 3.51


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.