Multiple sequence alignment - TraesCS7B01G424500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G424500 chr7B 100.000 2521 0 0 1 2521 693396297 693398817 0.000000e+00 4656.0
1 TraesCS7B01G424500 chr7B 100.000 2511 0 0 2711 5221 693399007 693401517 0.000000e+00 4638.0
2 TraesCS7B01G424500 chr7B 99.683 2521 7 1 1 2521 698932998 698935517 0.000000e+00 4610.0
3 TraesCS7B01G424500 chr7B 99.553 2462 8 3 2760 5221 698935528 698937986 0.000000e+00 4482.0
4 TraesCS7B01G424500 chr7B 87.317 1774 207 13 3453 5221 697076532 697078292 0.000000e+00 2013.0
5 TraesCS7B01G424500 chr7B 91.737 1416 98 10 867 2267 697074773 697076184 0.000000e+00 1949.0
6 TraesCS7B01G424500 chr7B 83.274 1411 213 17 3822 5221 697077687 697079085 0.000000e+00 1277.0
7 TraesCS7B01G424500 chr7B 83.036 1403 221 11 3828 5221 695741438 695740044 0.000000e+00 1256.0
8 TraesCS7B01G424500 chr7B 79.970 1313 204 40 1016 2296 697241454 697240169 0.000000e+00 913.0
9 TraesCS7B01G424500 chr7B 89.356 714 59 8 873 1574 695761156 695760448 0.000000e+00 881.0
10 TraesCS7B01G424500 chr7B 91.256 629 43 7 1570 2196 695748437 695747819 0.000000e+00 846.0
11 TraesCS7B01G424500 chr7B 94.431 413 23 0 3043 3455 13257884 13257472 2.050000e-178 636.0
12 TraesCS7B01G424500 chr7B 100.000 31 0 0 188 218 693396417 693396447 2.030000e-04 58.4
13 TraesCS7B01G424500 chr7B 100.000 31 0 0 121 151 693396484 693396514 2.030000e-04 58.4
14 TraesCS7B01G424500 chr7B 100.000 31 0 0 188 218 698933118 698933148 2.030000e-04 58.4
15 TraesCS7B01G424500 chr7B 100.000 31 0 0 121 151 698933185 698933215 2.030000e-04 58.4
16 TraesCS7B01G424500 chr7D 91.488 1633 109 13 863 2470 607955255 607953628 0.000000e+00 2218.0
17 TraesCS7B01G424500 chr7D 88.550 1773 188 9 3453 5221 607952960 607951199 0.000000e+00 2135.0
18 TraesCS7B01G424500 chr7D 83.843 1405 208 14 3828 5221 607951007 607949611 0.000000e+00 1319.0
19 TraesCS7B01G424500 chr7D 83.534 1409 215 11 3822 5221 607951806 607950406 0.000000e+00 1301.0
20 TraesCS7B01G424500 chr7D 81.942 1390 230 15 3822 5202 481666 480289 0.000000e+00 1157.0
21 TraesCS7B01G424500 chr7D 80.692 1388 238 24 3828 5202 983063 981693 0.000000e+00 1051.0
22 TraesCS7B01G424500 chr7D 79.750 1200 202 30 1146 2316 608812479 608811292 0.000000e+00 832.0
23 TraesCS7B01G424500 chr1A 94.928 414 17 4 3042 3452 27328799 27328387 0.000000e+00 645.0
24 TraesCS7B01G424500 chr2A 94.498 418 19 4 3038 3453 61475553 61475968 4.410000e-180 641.0
25 TraesCS7B01G424500 chr7A 94.431 413 18 5 3044 3452 640496593 640497004 9.540000e-177 630.0
26 TraesCS7B01G424500 chr7A 94.019 418 19 5 3039 3452 558102220 558102635 3.430000e-176 628.0
27 TraesCS7B01G424500 chr3D 94.404 411 21 2 3044 3452 3101958 3102368 9.540000e-177 630.0
28 TraesCS7B01G424500 chr6B 94.390 410 21 2 3044 3453 355968002 355967595 3.430000e-176 628.0
29 TraesCS7B01G424500 chr5B 94.404 411 17 5 3044 3452 648258637 648258231 1.230000e-175 627.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G424500 chr7B 693396297 693401517 5220 False 2352.700000 4656 100.000000 1 5221 4 chr7B.!!$F1 5220
1 TraesCS7B01G424500 chr7B 698932998 698937986 4988 False 2302.200000 4610 99.809000 1 5221 4 chr7B.!!$F3 5220
2 TraesCS7B01G424500 chr7B 697074773 697079085 4312 False 1746.333333 2013 87.442667 867 5221 3 chr7B.!!$F2 4354
3 TraesCS7B01G424500 chr7B 695740044 695741438 1394 True 1256.000000 1256 83.036000 3828 5221 1 chr7B.!!$R2 1393
4 TraesCS7B01G424500 chr7B 697240169 697241454 1285 True 913.000000 913 79.970000 1016 2296 1 chr7B.!!$R5 1280
5 TraesCS7B01G424500 chr7B 695760448 695761156 708 True 881.000000 881 89.356000 873 1574 1 chr7B.!!$R4 701
6 TraesCS7B01G424500 chr7B 695747819 695748437 618 True 846.000000 846 91.256000 1570 2196 1 chr7B.!!$R3 626
7 TraesCS7B01G424500 chr7D 607949611 607955255 5644 True 1743.250000 2218 86.853750 863 5221 4 chr7D.!!$R4 4358
8 TraesCS7B01G424500 chr7D 480289 481666 1377 True 1157.000000 1157 81.942000 3822 5202 1 chr7D.!!$R1 1380
9 TraesCS7B01G424500 chr7D 981693 983063 1370 True 1051.000000 1051 80.692000 3828 5202 1 chr7D.!!$R2 1374
10 TraesCS7B01G424500 chr7D 608811292 608812479 1187 True 832.000000 832 79.750000 1146 2316 1 chr7D.!!$R3 1170

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
82 83 2.492088 TGACGTCGTGAAGGAATCTGAT 59.508 45.455 11.62 0.0 0.0 2.90 F
2176 2256 2.094100 TGGAGGAAGAGGGATAGCAG 57.906 55.000 0.00 0.0 0.0 4.24 F
2748 2960 4.013728 ACATGCCCGCTTGAAAAAGTATA 58.986 39.130 9.33 0.0 0.0 1.47 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2724 2936 2.625790 ACTTTTTCAAGCGGGCATGTAA 59.374 40.909 0.00 0.00 32.57 2.41 R
3443 3664 1.125633 TGTAGGAGCCCGGGAAATAC 58.874 55.000 29.31 20.15 0.00 1.89 R
5166 7775 1.202114 GAATTGGCCGCAATTGAGTGA 59.798 47.619 10.34 0.00 35.18 3.41 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
82 83 2.492088 TGACGTCGTGAAGGAATCTGAT 59.508 45.455 11.62 0.0 0.00 2.90
1441 1450 3.128349 GACAAGCGTCTGTCTGGTAAAA 58.872 45.455 10.63 0.0 42.11 1.52
1835 1890 2.166459 ACAGATGGTGATACTGACGGTG 59.834 50.000 0.00 0.0 35.85 4.94
2176 2256 2.094100 TGGAGGAAGAGGGATAGCAG 57.906 55.000 0.00 0.0 0.00 4.24
2748 2960 4.013728 ACATGCCCGCTTGAAAAAGTATA 58.986 39.130 9.33 0.0 0.00 1.47
3443 3664 7.485913 GTGCATATACAACCAAGAATCAAAGTG 59.514 37.037 0.00 0.0 0.00 3.16
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
65 66 4.499183 ACAAGATCAGATTCCTTCACGAC 58.501 43.478 0.00 0.00 0.00 4.34
82 83 4.165372 ACCCCTCTAAACACTTTGACAAGA 59.835 41.667 0.00 0.00 33.72 3.02
504 505 8.355272 TGTATTTGCGTGTATCATATTAACGT 57.645 30.769 0.00 0.00 36.65 3.99
2724 2936 2.625790 ACTTTTTCAAGCGGGCATGTAA 59.374 40.909 0.00 0.00 32.57 2.41
2730 2942 9.908152 AATATTAATATACTTTTTCAAGCGGGC 57.092 29.630 8.39 0.00 32.57 6.13
3309 3530 7.662604 TGCACTAGTATATAAATCTCGACGA 57.337 36.000 0.00 0.00 0.00 4.20
3438 3659 1.340697 GGAGCCCGGGAAATACACTTT 60.341 52.381 29.31 0.00 0.00 2.66
3443 3664 1.125633 TGTAGGAGCCCGGGAAATAC 58.874 55.000 29.31 20.15 0.00 1.89
4353 5365 4.404715 TGGAGGACCTAGCTTGTATACAAC 59.595 45.833 14.35 11.20 37.04 3.32
5166 7775 1.202114 GAATTGGCCGCAATTGAGTGA 59.798 47.619 10.34 0.00 35.18 3.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.