Multiple sequence alignment - TraesCS7B01G420300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G420300 chr7B 100.000 2573 0 0 1 2573 689858696 689856124 0.000000e+00 4752
1 TraesCS7B01G420300 chr6B 96.850 2603 51 10 1 2573 4274397 4276998 0.000000e+00 4324
2 TraesCS7B01G420300 chr7D 94.519 2591 82 15 1 2563 633361419 633358861 0.000000e+00 3943
3 TraesCS7B01G420300 chr5D 91.908 2558 160 19 18 2562 74185928 74188451 0.000000e+00 3533
4 TraesCS7B01G420300 chr5D 84.609 2599 334 45 1 2563 357882663 357885231 0.000000e+00 2523
5 TraesCS7B01G420300 chr3B 93.362 1883 99 12 698 2573 744536920 744535057 0.000000e+00 2761
6 TraesCS7B01G420300 chr3B 88.182 770 70 9 1 761 744537681 744536924 0.000000e+00 898
7 TraesCS7B01G420300 chr1A 95.525 1676 70 3 898 2573 577423363 577421693 0.000000e+00 2675
8 TraesCS7B01G420300 chr1A 88.427 674 44 16 256 906 577425056 577424394 0.000000e+00 782
9 TraesCS7B01G420300 chr1A 94.677 263 11 1 1 260 577444911 577444649 3.080000e-109 405
10 TraesCS7B01G420300 chr3D 84.796 2598 332 42 1 2563 420456271 420458840 0.000000e+00 2551
11 TraesCS7B01G420300 chr2D 84.831 2571 331 37 26 2563 616986531 616989075 0.000000e+00 2532
12 TraesCS7B01G420300 chr2D 84.818 2549 327 38 49 2563 536085764 536083242 0.000000e+00 2508
13 TraesCS7B01G420300 chr2D 84.456 2599 336 47 1 2563 577711192 577708626 0.000000e+00 2499
14 TraesCS7B01G420300 chr2B 94.293 1612 49 10 1 1579 769982889 769984490 0.000000e+00 2427
15 TraesCS7B01G420300 chr2B 76.399 411 86 8 105 508 588155610 588156016 7.210000e-51 211
16 TraesCS7B01G420300 chr2A 81.757 1628 243 38 53 1650 594578503 594576900 0.000000e+00 1312
17 TraesCS7B01G420300 chr3A 79.414 1127 181 35 1 1112 364140801 364141891 0.000000e+00 749


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G420300 chr7B 689856124 689858696 2572 True 4752.0 4752 100.000 1 2573 1 chr7B.!!$R1 2572
1 TraesCS7B01G420300 chr6B 4274397 4276998 2601 False 4324.0 4324 96.850 1 2573 1 chr6B.!!$F1 2572
2 TraesCS7B01G420300 chr7D 633358861 633361419 2558 True 3943.0 3943 94.519 1 2563 1 chr7D.!!$R1 2562
3 TraesCS7B01G420300 chr5D 74185928 74188451 2523 False 3533.0 3533 91.908 18 2562 1 chr5D.!!$F1 2544
4 TraesCS7B01G420300 chr5D 357882663 357885231 2568 False 2523.0 2523 84.609 1 2563 1 chr5D.!!$F2 2562
5 TraesCS7B01G420300 chr3B 744535057 744537681 2624 True 1829.5 2761 90.772 1 2573 2 chr3B.!!$R1 2572
6 TraesCS7B01G420300 chr1A 577421693 577425056 3363 True 1728.5 2675 91.976 256 2573 2 chr1A.!!$R2 2317
7 TraesCS7B01G420300 chr3D 420456271 420458840 2569 False 2551.0 2551 84.796 1 2563 1 chr3D.!!$F1 2562
8 TraesCS7B01G420300 chr2D 616986531 616989075 2544 False 2532.0 2532 84.831 26 2563 1 chr2D.!!$F1 2537
9 TraesCS7B01G420300 chr2D 536083242 536085764 2522 True 2508.0 2508 84.818 49 2563 1 chr2D.!!$R1 2514
10 TraesCS7B01G420300 chr2D 577708626 577711192 2566 True 2499.0 2499 84.456 1 2563 1 chr2D.!!$R2 2562
11 TraesCS7B01G420300 chr2B 769982889 769984490 1601 False 2427.0 2427 94.293 1 1579 1 chr2B.!!$F2 1578
12 TraesCS7B01G420300 chr2A 594576900 594578503 1603 True 1312.0 1312 81.757 53 1650 1 chr2A.!!$R1 1597
13 TraesCS7B01G420300 chr3A 364140801 364141891 1090 False 749.0 749 79.414 1 1112 1 chr3A.!!$F1 1111

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
201 205 5.24373 CCACAATGGTCCTGTTCTTTATGTT 59.756 40.0 0.0 0.0 31.35 2.71 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2034 3230 1.674441 CACTCATGTGCCCTATGCTTG 59.326 52.381 0.0 0.0 42.0 4.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
136 137 5.739959 TCAGTTAAATCATGGATCCGAACA 58.260 37.500 7.39 0.00 0.00 3.18
201 205 5.243730 CCACAATGGTCCTGTTCTTTATGTT 59.756 40.000 0.00 0.00 31.35 2.71
363 368 6.152661 AGAGTCTGGTGTTTTTGTTTGATGAA 59.847 34.615 0.00 0.00 0.00 2.57
739 850 7.995289 AGTCAATGTTCAGAACAATACAACAA 58.005 30.769 19.92 0.00 45.86 2.83
1130 2321 5.506317 GCAAGTATCCCAGATACAACAATGC 60.506 44.000 15.20 12.54 0.00 3.56
1135 2326 3.025978 CCCAGATACAACAATGCCACAT 58.974 45.455 0.00 0.00 0.00 3.21
1483 2674 4.397417 GCATCAAAGCAATAGTTCTCCAGT 59.603 41.667 0.00 0.00 0.00 4.00
1572 2763 5.916318 AGAGCTGGAATGAAGAATGAGTAG 58.084 41.667 0.00 0.00 0.00 2.57
1631 2822 2.664402 AATCCAGGAAGCACTGTTGT 57.336 45.000 0.00 0.00 36.75 3.32
1681 2872 9.260002 TGGAAGAAAACATATTTCAAAGCTTTC 57.740 29.630 9.23 0.00 0.00 2.62
2003 3199 4.156556 GCCAAATGCAGAGAACAGAATGTA 59.843 41.667 0.00 0.00 45.93 2.29
2034 3230 6.551385 CATATCTATGCCAACTGGAGAAAC 57.449 41.667 0.00 0.00 37.39 2.78
2267 3464 9.715121 ATCTTTTAATCATGCAATTGTTGAAGT 57.285 25.926 14.49 9.73 0.00 3.01
2477 3677 4.503714 AAGTCAAACTTCTCACTGGGAA 57.496 40.909 0.00 0.00 31.77 3.97
2544 3744 1.903877 GCTACTTCCAGCTGGCAGGA 61.904 60.000 31.88 25.23 38.57 3.86
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
201 205 0.982852 ACATCTCTTCATCGCCCCCA 60.983 55.000 0.00 0.00 0.00 4.96
363 368 5.590259 GTCTGCCATATTCATACAACCACTT 59.410 40.000 0.00 0.00 0.00 3.16
1130 2321 9.559732 TTAATGAGAAGTGTGGAATATATGTGG 57.440 33.333 0.00 0.00 0.00 4.17
1472 2663 7.418337 TCAGCAAACATATACTGGAGAACTA 57.582 36.000 0.00 0.00 0.00 2.24
1483 2674 9.836864 AGAAGTTGATACATCAGCAAACATATA 57.163 29.630 8.50 0.00 40.03 0.86
1572 2763 6.072119 CCAGTTGGTAATCAAAAACCCTAGTC 60.072 42.308 0.00 0.00 37.08 2.59
1765 2960 2.171448 ACAACAGCTCTCCTTTCACAGT 59.829 45.455 0.00 0.00 0.00 3.55
1916 3112 1.843368 AATGAACACCCATCCAGCTG 58.157 50.000 6.78 6.78 0.00 4.24
2034 3230 1.674441 CACTCATGTGCCCTATGCTTG 59.326 52.381 0.00 0.00 42.00 4.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.