Multiple sequence alignment - TraesCS7B01G416500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G416500 chr7B 100.000 2741 0 0 1 2741 684617008 684614268 0.000000e+00 5062.0
1 TraesCS7B01G416500 chr7B 97.147 2138 29 7 604 2741 684644299 684642194 0.000000e+00 3581.0
2 TraesCS7B01G416500 chr7B 98.611 1296 18 0 1446 2741 684685262 684683967 0.000000e+00 2294.0
3 TraesCS7B01G416500 chr7B 100.000 495 0 0 2247 2741 684647109 684646615 0.000000e+00 915.0
4 TraesCS7B01G416500 chr7B 91.383 441 37 1 1331 1770 685378943 685379383 1.090000e-168 603.0
5 TraesCS7B01G416500 chr7B 92.996 257 17 1 994 1249 685378639 685378895 9.270000e-100 374.0
6 TraesCS7B01G416500 chrUn 98.139 2741 31 6 1 2741 202525060 202522340 0.000000e+00 4761.0
7 TraesCS7B01G416500 chrUn 97.979 2375 28 5 367 2741 197869979 197867625 0.000000e+00 4102.0
8 TraesCS7B01G416500 chrUn 97.615 2138 30 6 604 2741 224017437 224015321 0.000000e+00 3646.0
9 TraesCS7B01G416500 chrUn 97.198 1463 21 5 851 2313 399485288 399486730 0.000000e+00 2457.0
10 TraesCS7B01G416500 chrUn 98.650 1111 15 0 1 1111 270094405 270093295 0.000000e+00 1969.0
11 TraesCS7B01G416500 chrUn 99.175 848 7 0 1 848 341200776 341201623 0.000000e+00 1528.0
12 TraesCS7B01G416500 chrUn 98.939 848 9 0 1 848 341198256 341199103 0.000000e+00 1517.0
13 TraesCS7B01G416500 chrUn 99.237 786 6 0 1 786 373111563 373112348 0.000000e+00 1419.0
14 TraesCS7B01G416500 chrUn 87.411 699 63 15 312 991 398716727 398717419 0.000000e+00 780.0
15 TraesCS7B01G416500 chrUn 89.385 179 15 3 1768 1945 23713744 23713569 3.550000e-54 222.0
16 TraesCS7B01G416500 chr7A 88.486 799 70 11 994 1770 696251496 696252294 0.000000e+00 946.0
17 TraesCS7B01G416500 chr7A 87.799 795 78 13 994 1770 696200589 696199796 0.000000e+00 913.0
18 TraesCS7B01G416500 chr7A 90.736 367 31 3 625 991 724641430 724641793 1.140000e-133 486.0
19 TraesCS7B01G416500 chr7D 88.287 794 74 14 994 1770 603500047 603499256 0.000000e+00 933.0
20 TraesCS7B01G416500 chr7D 88.690 336 37 1 1334 1668 603646474 603646809 2.540000e-110 409.0
21 TraesCS7B01G416500 chr7D 89.701 301 29 2 1 300 2674341 2674042 1.540000e-102 383.0
22 TraesCS7B01G416500 chr7D 89.369 301 29 3 1 300 69475751 69475453 2.580000e-100 375.0
23 TraesCS7B01G416500 chr6B 87.554 699 62 15 312 991 591510541 591509849 0.000000e+00 785.0
24 TraesCS7B01G416500 chr6B 87.411 699 63 15 312 991 591517609 591516917 0.000000e+00 780.0
25 TraesCS7B01G416500 chr6B 95.106 470 18 5 1978 2443 164871703 164872171 0.000000e+00 736.0
26 TraesCS7B01G416500 chr3B 95.896 463 16 3 1978 2439 11640813 11640353 0.000000e+00 747.0
27 TraesCS7B01G416500 chr5D 94.255 470 23 4 1977 2443 390503067 390502599 0.000000e+00 715.0
28 TraesCS7B01G416500 chr1B 93.978 465 26 2 1980 2443 605667970 605668433 0.000000e+00 702.0
29 TraesCS7B01G416500 chr1B 99.336 301 2 0 2441 2741 222254752 222254452 1.860000e-151 545.0
30 TraesCS7B01G416500 chr2B 99.013 304 2 1 2438 2741 125139911 125140213 6.680000e-151 544.0
31 TraesCS7B01G416500 chr2B 96.000 325 12 1 2416 2740 745924448 745924125 6.720000e-146 527.0
32 TraesCS7B01G416500 chr2B 88.925 307 30 4 1 305 747757395 747757699 2.580000e-100 375.0
33 TraesCS7B01G416500 chr2B 100.000 34 0 0 1944 1977 67070331 67070364 2.280000e-06 63.9
34 TraesCS7B01G416500 chr4A 92.098 367 25 4 627 991 190831943 190831579 5.230000e-142 514.0
35 TraesCS7B01G416500 chr4A 89.944 179 15 2 1768 1945 516181222 516181046 7.640000e-56 228.0
36 TraesCS7B01G416500 chr1D 89.577 307 29 3 1 305 440059893 440059588 1.190000e-103 387.0
37 TraesCS7B01G416500 chr3D 90.000 180 13 4 1768 1945 578178789 578178965 7.640000e-56 228.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G416500 chr7B 684614268 684617008 2740 True 5062.0 5062 100.0000 1 2741 1 chr7B.!!$R1 2740
1 TraesCS7B01G416500 chr7B 684683967 684685262 1295 True 2294.0 2294 98.6110 1446 2741 1 chr7B.!!$R2 1295
2 TraesCS7B01G416500 chr7B 684642194 684647109 4915 True 2248.0 3581 98.5735 604 2741 2 chr7B.!!$R3 2137
3 TraesCS7B01G416500 chr7B 685378639 685379383 744 False 488.5 603 92.1895 994 1770 2 chr7B.!!$F1 776
4 TraesCS7B01G416500 chrUn 202522340 202525060 2720 True 4761.0 4761 98.1390 1 2741 1 chrUn.!!$R3 2740
5 TraesCS7B01G416500 chrUn 197867625 197869979 2354 True 4102.0 4102 97.9790 367 2741 1 chrUn.!!$R2 2374
6 TraesCS7B01G416500 chrUn 224015321 224017437 2116 True 3646.0 3646 97.6150 604 2741 1 chrUn.!!$R4 2137
7 TraesCS7B01G416500 chrUn 399485288 399486730 1442 False 2457.0 2457 97.1980 851 2313 1 chrUn.!!$F3 1462
8 TraesCS7B01G416500 chrUn 270093295 270094405 1110 True 1969.0 1969 98.6500 1 1111 1 chrUn.!!$R5 1110
9 TraesCS7B01G416500 chrUn 341198256 341201623 3367 False 1522.5 1528 99.0570 1 848 2 chrUn.!!$F4 847
10 TraesCS7B01G416500 chrUn 373111563 373112348 785 False 1419.0 1419 99.2370 1 786 1 chrUn.!!$F1 785
11 TraesCS7B01G416500 chrUn 398716727 398717419 692 False 780.0 780 87.4110 312 991 1 chrUn.!!$F2 679
12 TraesCS7B01G416500 chr7A 696251496 696252294 798 False 946.0 946 88.4860 994 1770 1 chr7A.!!$F1 776
13 TraesCS7B01G416500 chr7A 696199796 696200589 793 True 913.0 913 87.7990 994 1770 1 chr7A.!!$R1 776
14 TraesCS7B01G416500 chr7D 603499256 603500047 791 True 933.0 933 88.2870 994 1770 1 chr7D.!!$R3 776
15 TraesCS7B01G416500 chr6B 591509849 591510541 692 True 785.0 785 87.5540 312 991 1 chr6B.!!$R1 679
16 TraesCS7B01G416500 chr6B 591516917 591517609 692 True 780.0 780 87.4110 312 991 1 chr6B.!!$R2 679

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
117 118 1.746220 CACCGTCTTTTGTTCCAACCA 59.254 47.619 0.0 0.0 0.00 3.67 F
833 3053 1.778334 CGCGCCTGTGCTATTATGTA 58.222 50.000 0.0 0.0 34.43 2.29 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1529 5317 0.966920 CCTGAACCACCAGTCGTAGT 59.033 55.000 0.0 0.0 32.43 2.73 R
2115 6176 6.656632 TGTAGATGACAGGAAGCCTATTAG 57.343 41.667 0.0 0.0 32.86 1.73 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
117 118 1.746220 CACCGTCTTTTGTTCCAACCA 59.254 47.619 0.00 0.0 0.00 3.67
624 2832 4.655649 TGACAACCTAGCTCATGATACCAT 59.344 41.667 0.00 0.0 0.00 3.55
833 3053 1.778334 CGCGCCTGTGCTATTATGTA 58.222 50.000 0.00 0.0 34.43 2.29
874 3802 7.094762 CGTGTGTCTAGCCTCACTATATATGAA 60.095 40.741 4.66 0.0 35.82 2.57
1383 5170 2.345760 GGCAGTTCGAGGGGTACGA 61.346 63.158 0.00 0.0 37.99 3.43
1622 5682 4.726039 CGAGATGCTGATCGTGCT 57.274 55.556 11.02 0.0 34.30 4.40
1716 5776 1.153349 GCGGTGGAGGGATCTCAAC 60.153 63.158 0.00 0.0 42.03 3.18
1918 5979 2.539003 CCAACAACGGCAGATCGAA 58.461 52.632 0.00 0.0 0.00 3.71
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
624 2832 9.005777 GGTATGCCTCGGATTTATTATAACAAA 57.994 33.333 0.00 0.0 0.00 2.83
765 2973 0.668096 TGTGCGGTATTGTGACGGTC 60.668 55.000 0.00 0.0 0.00 4.79
833 3053 2.083774 CACACGATGTAACCAATGCCT 58.916 47.619 0.00 0.0 0.00 4.75
874 3802 2.158943 GGACGCTTGTATTCTAGGCCTT 60.159 50.000 12.58 0.0 0.00 4.35
1406 5193 2.665000 CAGCATCACGGACACCCT 59.335 61.111 0.00 0.0 0.00 4.34
1444 5232 2.137425 ATCAGTGTCGTGTTCCGCGA 62.137 55.000 8.23 0.0 44.12 5.87
1529 5317 0.966920 CCTGAACCACCAGTCGTAGT 59.033 55.000 0.00 0.0 32.43 2.73
1610 5542 2.358372 TAGCCCAGCACGATCAGCA 61.358 57.895 9.51 0.0 0.00 4.41
2115 6176 6.656632 TGTAGATGACAGGAAGCCTATTAG 57.343 41.667 0.00 0.0 32.86 1.73


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.