Multiple sequence alignment - TraesCS7B01G403200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G403200 chr7B 100.000 2381 0 0 1 2381 671191572 671193952 0.000000e+00 4397
1 TraesCS7B01G403200 chr7B 98.739 2379 29 1 1 2379 670899164 670901541 0.000000e+00 4226
2 TraesCS7B01G403200 chr7B 98.739 2379 28 2 1 2379 670940795 670943171 0.000000e+00 4226
3 TraesCS7B01G403200 chr7B 98.587 2052 25 3 1 2051 671008731 671010779 0.000000e+00 3626
4 TraesCS7B01G403200 chr7B 99.024 1946 19 0 1 1946 671085767 671087712 0.000000e+00 3489
5 TraesCS7B01G403200 chr7B 95.409 2004 90 2 1 2002 670838950 670840953 0.000000e+00 3190
6 TraesCS7B01G403200 chr7B 95.207 2003 93 3 1 2002 670917831 670919831 0.000000e+00 3164
7 TraesCS7B01G403200 chr7B 98.113 371 7 0 2011 2381 671087715 671088085 0.000000e+00 647
8 TraesCS7B01G403200 chr7B 94.536 366 19 1 2014 2379 670483183 670483547 4.440000e-157 564
9 TraesCS7B01G403200 chr7B 94.536 366 19 1 2014 2379 670671883 670672247 4.440000e-157 564
10 TraesCS7B01G403200 chr7B 93.716 366 22 1 2014 2379 670501650 670502014 4.470000e-152 547
11 TraesCS7B01G403200 chr7B 92.141 369 26 2 2014 2379 670838941 670839309 3.510000e-143 518
12 TraesCS7B01G403200 chrUn 99.370 2381 15 0 1 2381 147244253 147246633 0.000000e+00 4314
13 TraesCS7B01G403200 chrUn 99.560 2044 9 0 1 2044 311423103 311421060 0.000000e+00 3725
14 TraesCS7B01G403200 chrUn 99.389 1963 12 0 419 2381 279381324 279383286 0.000000e+00 3559
15 TraesCS7B01G403200 chrUn 98.086 1620 16 1 1 1620 147162419 147164023 0.000000e+00 2806


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G403200 chr7B 671191572 671193952 2380 False 4397 4397 100.0000 1 2381 1 chr7B.!!$F8 2380
1 TraesCS7B01G403200 chr7B 670899164 670901541 2377 False 4226 4226 98.7390 1 2379 1 chr7B.!!$F4 2378
2 TraesCS7B01G403200 chr7B 670940795 670943171 2376 False 4226 4226 98.7390 1 2379 1 chr7B.!!$F6 2378
3 TraesCS7B01G403200 chr7B 671008731 671010779 2048 False 3626 3626 98.5870 1 2051 1 chr7B.!!$F7 2050
4 TraesCS7B01G403200 chr7B 670917831 670919831 2000 False 3164 3164 95.2070 1 2002 1 chr7B.!!$F5 2001
5 TraesCS7B01G403200 chr7B 671085767 671088085 2318 False 2068 3489 98.5685 1 2381 2 chr7B.!!$F10 2380
6 TraesCS7B01G403200 chr7B 670838941 670840953 2012 False 1854 3190 93.7750 1 2379 2 chr7B.!!$F9 2378
7 TraesCS7B01G403200 chrUn 147244253 147246633 2380 False 4314 4314 99.3700 1 2381 1 chrUn.!!$F2 2380
8 TraesCS7B01G403200 chrUn 311421060 311423103 2043 True 3725 3725 99.5600 1 2044 1 chrUn.!!$R1 2043
9 TraesCS7B01G403200 chrUn 279381324 279383286 1962 False 3559 3559 99.3890 419 2381 1 chrUn.!!$F3 1962
10 TraesCS7B01G403200 chrUn 147162419 147164023 1604 False 2806 2806 98.0860 1 1620 1 chrUn.!!$F1 1619

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
877 890 3.671928 GTGAAGCTGAAACGTACGTATGT 59.328 43.478 23.12 14.7 0.0 2.29 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2044 2058 5.449553 AGAAAAAGGGCATTAGGGTATCTG 58.55 41.667 0.0 0.0 0.0 2.9 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
753 766 9.614792 GAGTAGGAGATATACAACCAAAACAAT 57.385 33.333 0.00 0.00 0.00 2.71
875 888 4.170292 AGTGAAGCTGAAACGTACGTAT 57.830 40.909 23.12 9.26 0.00 3.06
877 890 3.671928 GTGAAGCTGAAACGTACGTATGT 59.328 43.478 23.12 14.70 0.00 2.29
1234 1247 0.393132 GGCCAGACTGGTTAAGGAGC 60.393 60.000 22.58 5.50 40.46 4.70
2044 2058 2.386249 CGTCTTAGAGGATAGCGTTGC 58.614 52.381 0.00 0.00 0.00 4.17
2358 2372 1.985159 TGTGGTTCCCATCAGCTAAGT 59.015 47.619 0.00 0.00 35.28 2.24
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
753 766 6.633500 AGCTTGCATTGTTACTTTTCACTA 57.367 33.333 0.00 0.00 0.00 2.74
875 888 2.047370 ATCATGCCGTGCGTCACA 60.047 55.556 9.95 0.00 33.40 3.58
877 890 3.498834 GCATCATGCCGTGCGTCA 61.499 61.111 0.00 0.00 37.42 4.35
1234 1247 2.584418 CCTCGGTGCAGCGATCAG 60.584 66.667 37.55 26.35 0.00 2.90
2044 2058 5.449553 AGAAAAAGGGCATTAGGGTATCTG 58.550 41.667 0.00 0.00 0.00 2.90


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.