Multiple sequence alignment - TraesCS7B01G403100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G403100 chr7B 100.000 2381 0 0 1 2381 671085767 671088147 0 4397
1 TraesCS7B01G403100 chr7B 99.024 1946 19 0 1 1946 671191572 671193517 0 3489
2 TraesCS7B01G403100 chr7B 98.972 1946 19 1 1 1946 670899164 670901108 0 3482
3 TraesCS7B01G403100 chr7B 98.972 1946 18 2 1 1946 670940795 670942738 0 3482
4 TraesCS7B01G403100 chr7B 98.613 1947 23 3 1 1946 671008731 671010674 0 3443
5 TraesCS7B01G403100 chr7B 95.431 1948 87 2 1 1946 670838950 670840897 0 3103
6 TraesCS7B01G403100 chr7B 95.223 1947 90 3 1 1946 670917831 670919775 0 3077
7 TraesCS7B01G403100 chr7B 95.121 1947 92 3 1 1946 670888381 670890325 0 3066
8 TraesCS7B01G403100 chr7B 98.614 433 6 0 1949 2381 670942803 670943235 0 767
9 TraesCS7B01G403100 chr7B 98.383 433 7 0 1949 2381 670901173 670901605 0 761
10 TraesCS7B01G403100 chr7B 98.383 433 7 0 1949 2381 671193582 671194014 0 761
11 TraesCS7B01G403100 chr7B 94.884 430 21 1 1952 2381 670671883 670672311 0 671
12 TraesCS7B01G403100 chrUn 98.972 1946 20 0 1 1946 311423103 311421158 0 3483
13 TraesCS7B01G403100 chrUn 98.818 1946 23 0 1 1946 147244253 147246198 0 3467
14 TraesCS7B01G403100 chrUn 98.845 433 5 0 1949 2381 382033989 382034421 0 773
15 TraesCS7B01G403100 chrUn 98.614 433 6 0 1949 2381 147176520 147176952 0 767
16 TraesCS7B01G403100 chrUn 98.614 433 6 0 1949 2381 147246263 147246695 0 767
17 TraesCS7B01G403100 chrUn 98.614 433 6 0 1949 2381 279382916 279383348 0 767
18 TraesCS7B01G403100 chrUn 98.614 433 6 0 1949 2381 382010022 382009590 0 767


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G403100 chr7B 671085767 671088147 2380 False 4397.0 4397 100.0000 1 2381 1 chr7B.!!$F6 2380
1 TraesCS7B01G403100 chr7B 671008731 671010674 1943 False 3443.0 3443 98.6130 1 1946 1 chr7B.!!$F5 1945
2 TraesCS7B01G403100 chr7B 670838950 670840897 1947 False 3103.0 3103 95.4310 1 1946 1 chr7B.!!$F2 1945
3 TraesCS7B01G403100 chr7B 670917831 670919775 1944 False 3077.0 3077 95.2230 1 1946 1 chr7B.!!$F4 1945
4 TraesCS7B01G403100 chr7B 670888381 670890325 1944 False 3066.0 3066 95.1210 1 1946 1 chr7B.!!$F3 1945
5 TraesCS7B01G403100 chr7B 671191572 671194014 2442 False 2125.0 3489 98.7035 1 2381 2 chr7B.!!$F9 2380
6 TraesCS7B01G403100 chr7B 670940795 670943235 2440 False 2124.5 3482 98.7930 1 2381 2 chr7B.!!$F8 2380
7 TraesCS7B01G403100 chr7B 670899164 670901605 2441 False 2121.5 3482 98.6775 1 2381 2 chr7B.!!$F7 2380
8 TraesCS7B01G403100 chrUn 311421158 311423103 1945 True 3483.0 3483 98.9720 1 1946 1 chrUn.!!$R1 1945
9 TraesCS7B01G403100 chrUn 147244253 147246695 2442 False 2117.0 3467 98.7160 1 2381 2 chrUn.!!$F4 2380

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
951 955 2.159099 TCTATCGTCTTGCACACATCCC 60.159 50.0 0.0 0.0 0.0 3.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2263 2330 0.746659 AACCACACTTTTCTGCTGCC 59.253 50.0 0.0 0.0 0.0 4.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
951 955 2.159099 TCTATCGTCTTGCACACATCCC 60.159 50.000 0.00 0.00 0.00 3.85
1140 1144 1.305381 CTCTTCCCCCGAGGTCACT 60.305 63.158 0.00 0.00 36.75 3.41
1425 1429 5.971763 AGAACAGCAATAAGTACTCTCCAG 58.028 41.667 0.00 0.00 0.00 3.86
1499 1503 7.275560 GGAATCAACCCGAAATTAAACAATCAG 59.724 37.037 0.00 0.00 0.00 2.90
1603 1607 3.007398 GGTGCCCACAAATATTTGGAACA 59.993 43.478 27.43 18.01 42.34 3.18
1837 1842 3.206866 AGGGTTAGGTCTATGAGGTAGCA 59.793 47.826 0.00 0.00 0.00 3.49
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
72 73 9.801873 CATTTCCGTAAATGTATCTCCAAAAAT 57.198 29.630 5.36 0.0 44.62 1.82
951 955 0.107703 TGCCCTTTGAGGTAGATGCG 60.108 55.000 0.00 0.0 31.93 4.73
1425 1429 6.760291 TCTCTCTCTTAGTTCCTTGGTTTTC 58.240 40.000 0.00 0.0 0.00 2.29
1499 1503 2.586648 AGAATGGTGAAGGGGTCAAC 57.413 50.000 0.00 0.0 45.03 3.18
1603 1607 1.971357 CTGGACTAGGTTGTGGACTGT 59.029 52.381 0.00 0.0 0.00 3.55
1837 1842 0.888285 GCAGCTGCTGAACTCCACTT 60.888 55.000 32.30 0.0 38.21 3.16
1946 1951 7.260387 TCTAAGACGGAGATAGTATCCTCAT 57.740 40.000 6.53 0.0 34.45 2.90
1947 1952 6.295973 CCTCTAAGACGGAGATAGTATCCTCA 60.296 46.154 6.53 0.0 34.45 3.86
2263 2330 0.746659 AACCACACTTTTCTGCTGCC 59.253 50.000 0.00 0.0 0.00 4.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.