Multiple sequence alignment - TraesCS7B01G400000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G400000 chr7B 100.000 2663 0 0 1 2663 666524118 666526780 0 4918
1 TraesCS7B01G400000 chr7B 98.949 2663 28 0 1 2663 194130141 194127479 0 4763
2 TraesCS7B01G400000 chr6A 98.949 2663 26 2 1 2663 87943545 87940885 0 4761
3 TraesCS7B01G400000 chr6A 98.873 2663 29 1 1 2663 480640271 480637610 0 4750
4 TraesCS7B01G400000 chr6A 98.386 2664 40 3 1 2663 12690992 12693653 0 4678
5 TraesCS7B01G400000 chr2B 98.723 2663 33 1 1 2663 608457624 608460285 0 4728
6 TraesCS7B01G400000 chr2A 98.462 2666 37 4 1 2663 389206954 389209618 0 4693
7 TraesCS7B01G400000 chr5A 98.382 2658 42 1 6 2663 17467852 17465196 0 4669


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G400000 chr7B 666524118 666526780 2662 False 4918 4918 100.000 1 2663 1 chr7B.!!$F1 2662
1 TraesCS7B01G400000 chr7B 194127479 194130141 2662 True 4763 4763 98.949 1 2663 1 chr7B.!!$R1 2662
2 TraesCS7B01G400000 chr6A 87940885 87943545 2660 True 4761 4761 98.949 1 2663 1 chr6A.!!$R1 2662
3 TraesCS7B01G400000 chr6A 480637610 480640271 2661 True 4750 4750 98.873 1 2663 1 chr6A.!!$R2 2662
4 TraesCS7B01G400000 chr6A 12690992 12693653 2661 False 4678 4678 98.386 1 2663 1 chr6A.!!$F1 2662
5 TraesCS7B01G400000 chr2B 608457624 608460285 2661 False 4728 4728 98.723 1 2663 1 chr2B.!!$F1 2662
6 TraesCS7B01G400000 chr2A 389206954 389209618 2664 False 4693 4693 98.462 1 2663 1 chr2A.!!$F1 2662
7 TraesCS7B01G400000 chr5A 17465196 17467852 2656 True 4669 4669 98.382 6 2663 1 chr5A.!!$R1 2657

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
642 644 3.981071 AGAACATACTGCCTAGTTGCA 57.019 42.857 0.00 0.00 38.36 4.08 F
1458 1461 1.605451 AGGTGATCGTGACGGTCCA 60.605 57.895 16.35 3.35 35.99 4.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1467 1470 0.469331 CATGGGATGCAGCCTCCAAT 60.469 55.000 22.39 9.76 34.24 3.16 R
2336 2343 1.374631 CTAGTTGCAGAGTGGCGCA 60.375 57.895 10.83 0.00 36.28 6.09 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
642 644 3.981071 AGAACATACTGCCTAGTTGCA 57.019 42.857 0.00 0.00 38.36 4.08
1092 1095 2.106923 TACAGGCAGGACTCAGGGGT 62.107 60.000 0.00 0.00 0.00 4.95
1458 1461 1.605451 AGGTGATCGTGACGGTCCA 60.605 57.895 16.35 3.35 35.99 4.02
1467 1470 3.948719 GACGGTCCAACTGCCCCA 61.949 66.667 0.00 0.00 0.00 4.96
1751 1754 2.582052 GGACCAAGTGGACACATTCAA 58.418 47.619 3.83 0.00 38.94 2.69
1813 1817 8.409371 TGAATTAGTTCATGCACTGTGTAAAAA 58.591 29.630 8.37 1.29 39.36 1.94
2336 2343 4.141287 TGTGCCACTTTGCAACTACTTAT 58.859 39.130 0.00 0.00 44.11 1.73
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
819 821 2.030451 GGTAATTACCTAGACGGCGAGG 60.030 54.545 24.79 16.95 43.10 4.63
1338 1341 4.792521 TTTTGTGCAACTAACTGGTTGT 57.207 36.364 7.64 0.00 45.69 3.32
1458 1461 2.037847 GCCTCCAATGGGGCAGTT 59.962 61.111 21.67 0.00 46.84 3.16
1467 1470 0.469331 CATGGGATGCAGCCTCCAAT 60.469 55.000 22.39 9.76 34.24 3.16
1631 1634 4.234019 GTGGACACACACCAGCAA 57.766 55.556 0.00 0.00 46.90 3.91
1813 1817 5.427378 ACAAAGGCACAAATAGCAACTTTT 58.573 33.333 0.00 0.00 0.00 2.27
2021 2027 2.826128 TGCTGAGATACGACAAGGAGTT 59.174 45.455 0.00 0.00 0.00 3.01
2073 2079 1.134936 TGACGTATGATTGGGTCACCG 60.135 52.381 0.00 0.00 40.28 4.94
2179 2185 4.359434 TTGCAGTAATGAGTGTGGGTTA 57.641 40.909 0.00 0.00 0.00 2.85
2336 2343 1.374631 CTAGTTGCAGAGTGGCGCA 60.375 57.895 10.83 0.00 36.28 6.09


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.