Multiple sequence alignment - TraesCS7B01G397600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G397600 chr7B 100.000 1942 0 0 704 2645 663706720 663708661 0.000000e+00 3587.0
1 TraesCS7B01G397600 chr7B 99.485 1942 10 0 704 2645 663631054 663632995 0.000000e+00 3531.0
2 TraesCS7B01G397600 chr7B 99.382 1942 12 0 704 2645 663598235 663600176 0.000000e+00 3520.0
3 TraesCS7B01G397600 chr7B 99.125 1942 16 1 704 2645 663684216 663686156 0.000000e+00 3491.0
4 TraesCS7B01G397600 chr7B 99.220 1026 8 0 704 1729 663653113 663654138 0.000000e+00 1851.0
5 TraesCS7B01G397600 chr7B 100.000 648 0 0 1 648 663706017 663706664 0.000000e+00 1197.0
6 TraesCS7B01G397600 chr7B 98.157 651 8 2 1 648 663683482 663684131 0.000000e+00 1133.0
7 TraesCS7B01G397600 chr7B 97.994 648 8 3 1 648 663630332 663630974 0.000000e+00 1120.0
8 TraesCS7B01G397600 chr7B 96.759 648 12 3 1 648 663597517 663598155 0.000000e+00 1072.0
9 TraesCS7B01G397600 chr7B 98.177 384 6 1 1 384 663652422 663652804 0.000000e+00 669.0
10 TraesCS7B01G397600 chr7B 97.107 242 7 0 407 648 663652792 663653033 2.450000e-110 409.0
11 TraesCS7B01G397600 chr7B 100.000 29 0 0 1307 1335 226333861 226333889 1.000000e-03 54.7
12 TraesCS7B01G397600 chr7D 87.554 466 38 7 194 648 589338040 589338496 3.020000e-144 521.0
13 TraesCS7B01G397600 chr7D 75.858 816 145 29 721 1507 589195577 589196369 4.160000e-98 368.0
14 TraesCS7B01G397600 chr7D 87.879 231 28 0 417 647 589195246 589195476 3.350000e-69 272.0
15 TraesCS7B01G397600 chr7D 84.483 116 18 0 469 584 607931246 607931361 5.980000e-22 115.0
16 TraesCS7B01G397600 chr7D 85.981 107 15 0 478 584 609947236 609947130 5.980000e-22 115.0
17 TraesCS7B01G397600 chr7D 100.000 29 0 0 1307 1335 249375642 249375670 1.000000e-03 54.7
18 TraesCS7B01G397600 chr1B 79.167 120 24 1 470 589 632209438 632209556 6.070000e-12 82.4
19 TraesCS7B01G397600 chr7A 100.000 29 0 0 1307 1335 271792933 271792905 1.000000e-03 54.7


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G397600 chr7B 663706017 663708661 2644 False 2392.000000 3587 100.0000 1 2645 2 chr7B.!!$F6 2644
1 TraesCS7B01G397600 chr7B 663630332 663632995 2663 False 2325.500000 3531 98.7395 1 2645 2 chr7B.!!$F3 2644
2 TraesCS7B01G397600 chr7B 663683482 663686156 2674 False 2312.000000 3491 98.6410 1 2645 2 chr7B.!!$F5 2644
3 TraesCS7B01G397600 chr7B 663597517 663600176 2659 False 2296.000000 3520 98.0705 1 2645 2 chr7B.!!$F2 2644
4 TraesCS7B01G397600 chr7B 663652422 663654138 1716 False 976.333333 1851 98.1680 1 1729 3 chr7B.!!$F4 1728
5 TraesCS7B01G397600 chr7D 589195246 589196369 1123 False 320.000000 368 81.8685 417 1507 2 chr7D.!!$F4 1090

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
126 127 2.689983 GGAAGGCGATGAATCATGGTTT 59.31 45.455 0.0 0.0 0.0 3.27 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2262 2325 0.682852 TGTACAGAACTCCAACCGGG 59.317 55.0 6.32 0.0 38.37 5.73 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
64 65 6.335781 ACAAGATAGGAGTAGAAGGAGAGT 57.664 41.667 0.0 0.00 0.0 3.24
126 127 2.689983 GGAAGGCGATGAATCATGGTTT 59.310 45.455 0.0 0.00 0.0 3.27
1976 2039 8.138712 TGACCAGTTGTTTGTTTATAATGGAAC 58.861 33.333 0.0 2.08 0.0 3.62
2262 2325 5.582550 CAGAAGAAGTGGTTTTCTTGTTCC 58.417 41.667 5.8 0.00 45.0 3.62
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
64 65 1.339055 CGCTTCCATTTCTCCTCACCA 60.339 52.381 0.00 0.0 0.00 4.17
329 333 1.741327 TTGGGAGCGGCGGATACTAC 61.741 60.000 9.78 0.0 0.00 2.73
2262 2325 0.682852 TGTACAGAACTCCAACCGGG 59.317 55.000 6.32 0.0 38.37 5.73
2403 2466 1.479323 CCCAAGTTTCAGGATGCATGG 59.521 52.381 2.46 0.0 34.76 3.66


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.