Multiple sequence alignment - TraesCS7B01G397400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G397400 chr7B 100.000 3053 0 0 1 3053 663652002 663655054 0.000000e+00 5638.0
1 TraesCS7B01G397400 chr7B 98.738 1347 17 0 791 2137 663630733 663632079 0.000000e+00 2394.0
2 TraesCS7B01G397400 chr7B 98.664 1347 18 0 791 2137 663597914 663599260 0.000000e+00 2388.0
3 TraesCS7B01G397400 chr7B 98.587 1345 14 1 798 2137 663683897 663685241 0.000000e+00 2374.0
4 TraesCS7B01G397400 chr7B 99.220 1026 8 0 1112 2137 663706720 663707745 0.000000e+00 1851.0
5 TraesCS7B01G397400 chr7B 98.478 920 13 1 2134 3053 663686356 663687274 0.000000e+00 1620.0
6 TraesCS7B01G397400 chr7B 98.370 920 14 1 2134 3053 663633195 663634113 0.000000e+00 1615.0
7 TraesCS7B01G397400 chr7B 96.957 920 9 6 2134 3053 663600376 663601276 0.000000e+00 1526.0
8 TraesCS7B01G397400 chr7B 98.385 805 11 2 1 803 663705596 663706400 0.000000e+00 1413.0
9 TraesCS7B01G397400 chr7B 98.263 806 11 1 1 803 663683062 663683867 0.000000e+00 1408.0
10 TraesCS7B01G397400 chr7B 98.257 803 9 2 1 803 663629913 663630710 0.000000e+00 1400.0
11 TraesCS7B01G397400 chr7B 96.269 804 19 5 1 803 663597098 663597891 0.000000e+00 1308.0
12 TraesCS7B01G397400 chr7B 97.174 460 8 4 2595 3053 663709068 663709523 0.000000e+00 773.0
13 TraesCS7B01G397400 chr7B 97.107 242 7 0 791 1032 663706423 663706664 2.830000e-110 409.0
14 TraesCS7B01G397400 chr7B 99.548 221 1 0 2134 2354 663708861 663709081 1.320000e-108 403.0
15 TraesCS7B01G397400 chr7B 87.676 284 34 1 2503 2786 711887840 711888122 2.270000e-86 329.0
16 TraesCS7B01G397400 chr7B 100.000 30 0 0 1714 1743 226333860 226333889 4.250000e-04 56.5
17 TraesCS7B01G397400 chr7D 78.095 1155 195 32 794 1915 589195240 589196369 0.000000e+00 678.0
18 TraesCS7B01G397400 chr7D 84.364 550 66 12 2234 2774 601692947 601693485 3.490000e-144 521.0
19 TraesCS7B01G397400 chr7D 87.151 358 45 1 787 1144 589338252 589338608 3.670000e-109 405.0
20 TraesCS7B01G397400 chr7D 83.663 202 13 7 613 803 589338040 589338232 4.050000e-39 172.0
21 TraesCS7B01G397400 chr7D 77.083 240 46 6 862 1101 609947236 609947006 2.470000e-26 130.0
22 TraesCS7B01G397400 chr7D 75.904 249 51 6 853 1101 607931246 607931485 5.350000e-23 119.0
23 TraesCS7B01G397400 chr7D 100.000 30 0 0 1714 1743 249375641 249375670 4.250000e-04 56.5
24 TraesCS7B01G397400 chr2D 85.310 565 63 12 2234 2789 31475779 31476332 1.590000e-157 566.0
25 TraesCS7B01G397400 chr5D 80.624 609 61 24 2234 2786 547234724 547235331 4.710000e-113 418.0
26 TraesCS7B01G397400 chr1B 83.408 446 42 7 2260 2705 35013733 35014146 4.780000e-103 385.0
27 TraesCS7B01G397400 chr1B 83.184 446 43 7 2260 2705 35021627 35022040 2.220000e-101 379.0
28 TraesCS7B01G397400 chr1B 74.704 253 57 3 854 1100 632209438 632209689 4.160000e-19 106.0
29 TraesCS7B01G397400 chr4A 80.138 579 58 20 2234 2756 616626960 616626383 2.220000e-101 379.0
30 TraesCS7B01G397400 chr2B 88.772 285 31 1 2503 2787 47182883 47183166 6.270000e-92 348.0
31 TraesCS7B01G397400 chr3A 88.732 284 31 1 2503 2786 685357381 685357663 2.250000e-91 346.0
32 TraesCS7B01G397400 chr5A 87.797 295 34 2 2503 2796 357163917 357164210 8.100000e-91 344.0
33 TraesCS7B01G397400 chr1A 84.752 282 15 12 2234 2507 10967713 10967452 1.090000e-64 257.0
34 TraesCS7B01G397400 chrUn 91.573 178 15 0 2266 2443 478053623 478053446 2.350000e-61 246.0
35 TraesCS7B01G397400 chr7A 100.000 30 0 0 1714 1743 271792934 271792905 4.250000e-04 56.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G397400 chr7B 663652002 663655054 3052 False 5638.000000 5638 100.000000 1 3053 1 chr7B.!!$F2 3052
1 TraesCS7B01G397400 chr7B 663629913 663634113 4200 False 1803.000000 2394 98.455000 1 3053 3 chr7B.!!$F5 3052
2 TraesCS7B01G397400 chr7B 663683062 663687274 4212 False 1800.666667 2374 98.442667 1 3053 3 chr7B.!!$F6 3052
3 TraesCS7B01G397400 chr7B 663597098 663601276 4178 False 1740.666667 2388 97.296667 1 3053 3 chr7B.!!$F4 3052
4 TraesCS7B01G397400 chr7B 663705596 663709523 3927 False 969.800000 1851 98.286800 1 3053 5 chr7B.!!$F7 3052
5 TraesCS7B01G397400 chr7D 589195240 589196369 1129 False 678.000000 678 78.095000 794 1915 1 chr7D.!!$F2 1121
6 TraesCS7B01G397400 chr7D 601692947 601693485 538 False 521.000000 521 84.364000 2234 2774 1 chr7D.!!$F3 540
7 TraesCS7B01G397400 chr7D 589338040 589338608 568 False 288.500000 405 85.407000 613 1144 2 chr7D.!!$F5 531
8 TraesCS7B01G397400 chr2D 31475779 31476332 553 False 566.000000 566 85.310000 2234 2789 1 chr2D.!!$F1 555
9 TraesCS7B01G397400 chr5D 547234724 547235331 607 False 418.000000 418 80.624000 2234 2786 1 chr5D.!!$F1 552
10 TraesCS7B01G397400 chr4A 616626383 616626960 577 True 379.000000 379 80.138000 2234 2756 1 chr4A.!!$R1 522

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
242 243 0.321671 AGTACAACATCGCTGCCACT 59.678 50.000 0.0 0.0 0.0 4.00 F
1005 1063 1.770658 TCCTTCATCGGCTTCATGGAT 59.229 47.619 0.0 0.0 0.0 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1208 1274 0.106619 GAGCTCCGGGAAGAGGACTA 60.107 60.000 0.87 0.0 34.26 2.59 R
2907 4193 2.052941 CCGAAAACGCGTGCGAAA 60.053 55.556 24.61 0.0 42.83 3.46 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
242 243 0.321671 AGTACAACATCGCTGCCACT 59.678 50.000 0.0 0.0 0.00 4.00
1005 1063 1.770658 TCCTTCATCGGCTTCATGGAT 59.229 47.619 0.0 0.0 0.00 3.41
1208 1274 3.307762 GGCCACAAGAGAGACTATGGTTT 60.308 47.826 0.0 0.0 0.00 3.27
2900 4186 1.691434 GGTTGGGCACTTCATTTGGAA 59.309 47.619 0.0 0.0 0.00 3.53
2934 4220 1.967235 CGCGTTTTCGGCTTTTTAGAC 59.033 47.619 0.0 0.0 44.29 2.59
2938 4224 3.608474 CGTTTTCGGCTTTTTAGACAGGG 60.608 47.826 0.0 0.0 39.94 4.45
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
434 436 2.187100 CTTCTCCTCCTCTTCCTTGCT 58.813 52.381 0.00 0.0 0.00 3.91
491 493 2.012673 CCTTCCTCGCTTCCATTTCTG 58.987 52.381 0.00 0.0 0.00 3.02
774 797 2.523016 GGGGAGATGGATTGGCCC 59.477 66.667 0.00 0.0 38.08 5.80
1026 1084 2.294078 GGTGGTGTGAGGAGGGAGG 61.294 68.421 0.00 0.0 0.00 4.30
1208 1274 0.106619 GAGCTCCGGGAAGAGGACTA 60.107 60.000 0.87 0.0 34.26 2.59
2072 2165 8.801882 ATGAAGAAACGGAATAATAAGGTTGA 57.198 30.769 0.00 0.0 0.00 3.18
2907 4193 2.052941 CCGAAAACGCGTGCGAAA 60.053 55.556 24.61 0.0 42.83 3.46
2934 4220 3.243535 GCCAAGAGAACAGAAAAACCCTG 60.244 47.826 0.00 0.0 37.64 4.45
2938 4224 6.183360 CCAAAAAGCCAAGAGAACAGAAAAAC 60.183 38.462 0.00 0.0 0.00 2.43


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.