Multiple sequence alignment - TraesCS7B01G397300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G397300 chr7B 100.000 3245 0 0 1 3245 663629751 663632995 0.000000e+00 5993.0
1 TraesCS7B01G397300 chr7B 98.742 3258 27 5 1 3245 663682900 663686156 0.000000e+00 5777.0
2 TraesCS7B01G397300 chr7B 98.523 3249 36 5 1 3245 663596936 663600176 0.000000e+00 5723.0
3 TraesCS7B01G397300 chr7B 99.485 1942 10 0 1304 3245 663706720 663708661 0.000000e+00 3531.0
4 TraesCS7B01G397300 chr7B 98.738 1347 17 0 983 2329 663652792 663654138 0.000000e+00 2394.0
5 TraesCS7B01G397300 chr7B 98.294 1231 14 4 1 1224 663705434 663706664 0.000000e+00 2150.0
6 TraesCS7B01G397300 chr7B 98.549 965 9 2 1 960 663651840 663652804 0.000000e+00 1700.0
7 TraesCS7B01G397300 chr7B 100.000 29 0 0 1907 1935 226333861 226333889 2.000000e-03 54.7
8 TraesCS7B01G397300 chr7D 78.049 1148 195 30 993 2107 589195246 589196369 0.000000e+00 671.0
9 TraesCS7B01G397300 chr7D 86.888 572 55 7 775 1336 589338047 589338608 9.890000e-175 623.0
10 TraesCS7B01G397300 chr7D 77.083 240 46 5 1054 1293 609947236 609947006 2.630000e-26 130.0
11 TraesCS7B01G397300 chr7D 75.904 249 51 5 1045 1293 607931246 607931485 5.690000e-23 119.0
12 TraesCS7B01G397300 chr7D 100.000 29 0 0 1907 1935 249375642 249375670 2.000000e-03 54.7
13 TraesCS7B01G397300 chr1B 74.308 253 58 3 1046 1292 632209438 632209689 2.060000e-17 100.0
14 TraesCS7B01G397300 chr7A 100.000 29 0 0 1907 1935 271792933 271792905 2.000000e-03 54.7


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G397300 chr7B 663629751 663632995 3244 False 5993.0 5993 100.0000 1 3245 1 chr7B.!!$F3 3244
1 TraesCS7B01G397300 chr7B 663682900 663686156 3256 False 5777.0 5777 98.7420 1 3245 1 chr7B.!!$F4 3244
2 TraesCS7B01G397300 chr7B 663596936 663600176 3240 False 5723.0 5723 98.5230 1 3245 1 chr7B.!!$F2 3244
3 TraesCS7B01G397300 chr7B 663705434 663708661 3227 False 2840.5 3531 98.8895 1 3245 2 chr7B.!!$F6 3244
4 TraesCS7B01G397300 chr7B 663651840 663654138 2298 False 2047.0 2394 98.6435 1 2329 2 chr7B.!!$F5 2328
5 TraesCS7B01G397300 chr7D 589195246 589196369 1123 False 671.0 671 78.0490 993 2107 1 chr7D.!!$F2 1114
6 TraesCS7B01G397300 chr7D 589338047 589338608 561 False 623.0 623 86.8880 775 1336 1 chr7D.!!$F3 561

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
484 487 0.322187 CCGGATCCGTGGAAAAGGTT 60.322 55.0 31.22 0.0 37.81 3.50 F
579 582 0.869454 GTCGAGAGAAGCAGCATCCG 60.869 60.0 0.00 0.0 45.01 4.18 F
1455 1494 0.106769 TACACCGGCGATACCACCTA 60.107 55.0 9.30 0.0 39.03 3.08 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1456 1495 0.899019 TCGTCATGGATCGGTGGAAA 59.101 50.00 0.0 0.0 0.0 3.13 R
2014 2080 2.486472 ATCTTCTCCAACTGCCACTG 57.514 50.00 0.0 0.0 0.0 3.66 R
2547 2613 9.487790 CCATTATAAACAAACAACTGGTCAAAT 57.512 29.63 0.0 0.0 0.0 2.32 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
181 182 5.547465 ACAGAGTTAACAACATGGATCGAA 58.453 37.500 8.61 0.0 0.00 3.71
484 487 0.322187 CCGGATCCGTGGAAAAGGTT 60.322 55.000 31.22 0.0 37.81 3.50
579 582 0.869454 GTCGAGAGAAGCAGCATCCG 60.869 60.000 0.00 0.0 45.01 4.18
948 979 2.455565 CCGGCCAATCCATCTCCCT 61.456 63.158 2.24 0.0 34.01 4.20
1455 1494 0.106769 TACACCGGCGATACCACCTA 60.107 55.000 9.30 0.0 39.03 3.08
1456 1495 0.757935 ACACCGGCGATACCACCTAT 60.758 55.000 9.30 0.0 39.03 2.57
1469 1508 1.488812 CCACCTATTTCCACCGATCCA 59.511 52.381 0.00 0.0 0.00 3.41
2014 2080 6.381801 CAAAACACAGATGGGAGTAACAATC 58.618 40.000 0.00 0.0 0.00 2.67
2547 2613 4.937620 GCTTGTGGTATCAATCTCTTGACA 59.062 41.667 0.00 0.0 43.92 3.58
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
181 182 5.932303 CCGGTTGCTATTAATAGTGCTATGT 59.068 40.000 20.89 0.0 32.96 2.29
1455 1494 1.484653 TCGTCATGGATCGGTGGAAAT 59.515 47.619 0.00 0.0 0.00 2.17
1456 1495 0.899019 TCGTCATGGATCGGTGGAAA 59.101 50.000 0.00 0.0 0.00 3.13
1469 1508 3.138798 ACGCGGCTAGGTCGTCAT 61.139 61.111 12.47 0.0 31.29 3.06
2014 2080 2.486472 ATCTTCTCCAACTGCCACTG 57.514 50.000 0.00 0.0 0.00 3.66
2547 2613 9.487790 CCATTATAAACAAACAACTGGTCAAAT 57.512 29.630 0.00 0.0 0.00 2.32


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.