Multiple sequence alignment - TraesCS7B01G396300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G396300 chr7B 100.000 2372 0 0 1 2372 663099228 663096857 0.000000e+00 4381
1 TraesCS7B01G396300 chr3A 98.904 2372 26 0 1 2372 66004936 66002565 0.000000e+00 4237
2 TraesCS7B01G396300 chr6D 98.820 2372 28 0 1 2372 389245625 389243254 0.000000e+00 4226
3 TraesCS7B01G396300 chr5D 98.735 2372 30 0 1 2372 503264579 503262208 0.000000e+00 4215
4 TraesCS7B01G396300 chr5D 98.651 2372 32 0 1 2372 503245469 503247840 0.000000e+00 4204
5 TraesCS7B01G396300 chr2A 98.693 2372 31 0 1 2372 726906258 726903887 0.000000e+00 4209
6 TraesCS7B01G396300 chr2A 97.808 2372 49 2 1 2372 335847511 335849879 0.000000e+00 4089
7 TraesCS7B01G396300 chr2A 97.199 1428 40 0 945 2372 335821662 335820235 0.000000e+00 2416
8 TraesCS7B01G396300 chr2A 95.726 117 4 1 494 610 656137322 656137207 1.120000e-43 187
9 TraesCS7B01G396300 chr2A 97.917 96 2 0 429 524 158052844 158052939 1.460000e-37 167
10 TraesCS7B01G396300 chr2A 91.753 97 5 1 261 354 24302643 24302547 5.320000e-27 132
11 TraesCS7B01G396300 chr2A 98.305 59 1 0 19 77 110259751 110259809 1.160000e-18 104
12 TraesCS7B01G396300 chr2D 98.651 2372 32 0 1 2372 591984806 591987177 0.000000e+00 4204
13 TraesCS7B01G396300 chr3D 98.651 2372 31 1 1 2372 589263329 589260959 0.000000e+00 4202


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G396300 chr7B 663096857 663099228 2371 True 4381 4381 100.000 1 2372 1 chr7B.!!$R1 2371
1 TraesCS7B01G396300 chr3A 66002565 66004936 2371 True 4237 4237 98.904 1 2372 1 chr3A.!!$R1 2371
2 TraesCS7B01G396300 chr6D 389243254 389245625 2371 True 4226 4226 98.820 1 2372 1 chr6D.!!$R1 2371
3 TraesCS7B01G396300 chr5D 503262208 503264579 2371 True 4215 4215 98.735 1 2372 1 chr5D.!!$R1 2371
4 TraesCS7B01G396300 chr5D 503245469 503247840 2371 False 4204 4204 98.651 1 2372 1 chr5D.!!$F1 2371
5 TraesCS7B01G396300 chr2A 726903887 726906258 2371 True 4209 4209 98.693 1 2372 1 chr2A.!!$R4 2371
6 TraesCS7B01G396300 chr2A 335847511 335849879 2368 False 4089 4089 97.808 1 2372 1 chr2A.!!$F3 2371
7 TraesCS7B01G396300 chr2A 335820235 335821662 1427 True 2416 2416 97.199 945 2372 1 chr2A.!!$R2 1427
8 TraesCS7B01G396300 chr2D 591984806 591987177 2371 False 4204 4204 98.651 1 2372 1 chr2D.!!$F1 2371
9 TraesCS7B01G396300 chr3D 589260959 589263329 2370 True 4202 4202 98.651 1 2372 1 chr3D.!!$R1 2371

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
988 989 1.376037 CCTGAGAGGCGGTGGTTTC 60.376 63.158 0.0 0.0 0.0 2.78 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2206 2208 1.348775 GGGGCCTTAGCTGGTGATCT 61.349 60.0 0.84 0.0 39.73 2.75 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
324 325 4.772624 ACATGCCACTGAAAGACTCTACTA 59.227 41.667 0.00 0.0 37.43 1.82
342 343 6.779860 TCTACTAAGACAAAAAGATGGGCTT 58.220 36.000 0.00 0.0 38.88 4.35
746 747 7.951347 AACCAGCATTCTTAAGATCAAAGAT 57.049 32.000 5.89 0.0 33.17 2.40
789 790 1.489560 CCCCGTTCCTGGTTCTCCTT 61.490 60.000 0.00 0.0 34.23 3.36
988 989 1.376037 CCTGAGAGGCGGTGGTTTC 60.376 63.158 0.00 0.0 0.00 2.78
1004 1005 2.075355 TTTCCCCTGTGGCGGATGTT 62.075 55.000 0.00 0.0 0.00 2.71
1018 1019 1.134560 GGATGTTAGCGGTTCGAGTCT 59.865 52.381 0.00 0.0 0.00 3.24
1045 1046 1.003839 CCAGCCCGTGAACTTAGCA 60.004 57.895 0.00 0.0 0.00 3.49
1217 1218 0.689745 TTGCGGTGGATACCTAGGCT 60.690 55.000 9.30 0.0 45.22 4.58
1405 1406 2.238521 AGAAAGCAAAAGCGATTCCCA 58.761 42.857 0.00 0.0 0.00 4.37
1439 1440 2.091541 CGAAATGGGAGCAGCCTAAAA 58.908 47.619 0.00 0.0 36.66 1.52
1637 1638 3.669949 AGGCTAAATACTCCTGGGTGAT 58.330 45.455 0.00 0.0 0.00 3.06
1755 1756 1.550976 GGGAAAGTGATCTCTGACCGT 59.449 52.381 0.00 0.0 0.00 4.83
2084 2086 0.179094 CACTATTTCGGTGCGGGCTA 60.179 55.000 0.00 0.0 0.00 3.93
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
324 325 5.612725 TTGAAAGCCCATCTTTTTGTCTT 57.387 34.783 0.00 0.00 44.58 3.01
342 343 5.408824 TCCTACCTCCTCTACCTTTTTGAA 58.591 41.667 0.00 0.00 0.00 2.69
746 747 2.282603 CCCCTTTTTCCGCCCGAA 60.283 61.111 0.00 0.00 0.00 4.30
789 790 1.282738 GGTTCCGGGGAATCCAGTTAA 59.717 52.381 0.00 0.00 36.45 2.01
1004 1005 1.456296 TAAGCAGACTCGAACCGCTA 58.544 50.000 1.39 0.00 31.36 4.26
1018 1019 0.975556 TCACGGGCTGGAGATAAGCA 60.976 55.000 0.00 0.00 42.69 3.91
1045 1046 5.237561 CGGTGCTATCGCTATCATAGTATCT 59.762 44.000 0.00 0.00 36.97 1.98
1217 1218 1.000486 CCCTTCCTCGTCTCTGGGA 60.000 63.158 0.00 0.00 36.90 4.37
1405 1406 0.314302 ATTTCGCTCGCCGCTACTAT 59.686 50.000 0.00 0.00 36.73 2.12
1439 1440 1.378124 CCACAACCCCGTTTTCACGT 61.378 55.000 0.00 0.00 45.62 4.49
1637 1638 2.541346 CACGGTACTACTTCGCTATCGA 59.459 50.000 0.00 0.00 43.89 3.59
1755 1756 1.881973 GCTCATTCTTCAACAGGCACA 59.118 47.619 0.00 0.00 0.00 4.57
1833 1834 2.034305 TCGCCCTATTAAGACTCGCTTC 59.966 50.000 0.00 0.00 38.05 3.86
2034 2035 1.696336 AGATGTCCAGTCAACTGCTGT 59.304 47.619 4.58 0.00 42.47 4.40
2084 2086 1.808390 GATTTGGTACCGCTCGCGT 60.808 57.895 5.77 1.52 37.81 6.01
2206 2208 1.348775 GGGGCCTTAGCTGGTGATCT 61.349 60.000 0.84 0.00 39.73 2.75


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.