Multiple sequence alignment - TraesCS7B01G395900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G395900 chr7B 100.000 2246 0 0 1 2246 662756377 662754132 0 4148
1 TraesCS7B01G395900 chr3A 98.934 2252 16 4 1 2246 105558305 105556056 0 4019
2 TraesCS7B01G395900 chr5B 98.756 2250 24 2 1 2246 57516471 57514222 0 3997
3 TraesCS7B01G395900 chr1B 98.709 2247 25 4 1 2246 633715629 633717872 0 3986
4 TraesCS7B01G395900 chr5D 98.223 2251 30 8 1 2246 503338095 503340340 0 3927
5 TraesCS7B01G395900 chr5D 97.690 2251 37 8 1 2246 503312160 503314400 0 3855
6 TraesCS7B01G395900 chr5D 98.534 2183 20 5 69 2245 299973782 299971606 0 3843
7 TraesCS7B01G395900 chr1D 97.823 2251 32 8 1 2246 254458073 254460311 0 3869
8 TraesCS7B01G395900 chr1D 97.157 2251 47 10 1 2246 51833303 51831065 0 3786


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G395900 chr7B 662754132 662756377 2245 True 4148 4148 100.000 1 2246 1 chr7B.!!$R1 2245
1 TraesCS7B01G395900 chr3A 105556056 105558305 2249 True 4019 4019 98.934 1 2246 1 chr3A.!!$R1 2245
2 TraesCS7B01G395900 chr5B 57514222 57516471 2249 True 3997 3997 98.756 1 2246 1 chr5B.!!$R1 2245
3 TraesCS7B01G395900 chr1B 633715629 633717872 2243 False 3986 3986 98.709 1 2246 1 chr1B.!!$F1 2245
4 TraesCS7B01G395900 chr5D 503338095 503340340 2245 False 3927 3927 98.223 1 2246 1 chr5D.!!$F2 2245
5 TraesCS7B01G395900 chr5D 503312160 503314400 2240 False 3855 3855 97.690 1 2246 1 chr5D.!!$F1 2245
6 TraesCS7B01G395900 chr5D 299971606 299973782 2176 True 3843 3843 98.534 69 2245 1 chr5D.!!$R1 2176
7 TraesCS7B01G395900 chr1D 254458073 254460311 2238 False 3869 3869 97.823 1 2246 1 chr1D.!!$F1 2245
8 TraesCS7B01G395900 chr1D 51831065 51833303 2238 True 3786 3786 97.157 1 2246 1 chr1D.!!$R1 2245

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
95 96 3.436704 AGCGCCCACGAATGATATAAATG 59.563 43.478 2.29 0.00 43.93 2.32 F
421 422 5.426833 AGCCTATATAGGTGAATCCATGGAC 59.573 44.000 26.27 5.93 45.42 4.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1118 1133 1.001746 CTTCTGCTTCTGGCTGTCTCA 59.998 52.381 0.0 0.0 42.39 3.27 R
1390 1413 7.196901 CCCTTCCTAGAATGGGGTATTATCTA 58.803 42.308 0.0 0.0 37.33 1.98 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
95 96 3.436704 AGCGCCCACGAATGATATAAATG 59.563 43.478 2.29 0.00 43.93 2.32
421 422 5.426833 AGCCTATATAGGTGAATCCATGGAC 59.573 44.000 26.27 5.93 45.42 4.02
578 585 9.344772 GTTGTAGGAGAGAGAATAGAATAGACA 57.655 37.037 0.00 0.00 0.00 3.41
716 723 9.859427 CACTTTAAGCAATGATTTTAGAATCCA 57.141 29.630 3.70 0.00 40.79 3.41
1118 1133 4.532521 AGGACAAGCTGTAGAAGGTATTGT 59.467 41.667 0.00 0.00 34.84 2.71
1229 1248 2.817258 TGGCACTAGCGCTTTTATTTGT 59.183 40.909 18.68 0.57 43.41 2.83
1390 1413 8.624019 TCCTGGAATTATCTATTTATCGGGAT 57.376 34.615 0.00 0.00 29.47 3.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
95 96 5.408604 TGAGTAAAGCTAAAGCAACAGTAGC 59.591 40.000 4.54 0.0 45.16 3.58
421 422 8.800972 CAAAAATAGTCAATTCAATGATGACCG 58.199 33.333 11.97 0.0 43.46 4.79
1118 1133 1.001746 CTTCTGCTTCTGGCTGTCTCA 59.998 52.381 0.00 0.0 42.39 3.27
1390 1413 7.196901 CCCTTCCTAGAATGGGGTATTATCTA 58.803 42.308 0.00 0.0 37.33 1.98


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.