Multiple sequence alignment - TraesCS7B01G395700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G395700 chr7B 100.000 2330 0 0 1 2330 662740893 662743222 0 4303
1 TraesCS7B01G395700 chr3B 98.671 2333 23 4 1 2330 201489852 201487525 0 4130
2 TraesCS7B01G395700 chr3A 97.898 2331 40 5 1 2330 524025309 524022987 0 4024
3 TraesCS7B01G395700 chr3D 97.823 2343 28 7 1 2330 24162301 24159969 0 4023
4 TraesCS7B01G395700 chr1D 97.726 2331 41 4 1 2330 254473535 254471216 0 4000
5 TraesCS7B01G395700 chr5D 97.686 2334 36 10 1 2330 503327628 503325309 0 3995
6 TraesCS7B01G395700 chr5D 97.600 2333 41 8 1 2330 6239165 6241485 0 3984
7 TraesCS7B01G395700 chr5D 96.791 2275 57 8 1 2272 432308255 432310516 0 3783


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G395700 chr7B 662740893 662743222 2329 False 4303 4303 100.000 1 2330 1 chr7B.!!$F1 2329
1 TraesCS7B01G395700 chr3B 201487525 201489852 2327 True 4130 4130 98.671 1 2330 1 chr3B.!!$R1 2329
2 TraesCS7B01G395700 chr3A 524022987 524025309 2322 True 4024 4024 97.898 1 2330 1 chr3A.!!$R1 2329
3 TraesCS7B01G395700 chr3D 24159969 24162301 2332 True 4023 4023 97.823 1 2330 1 chr3D.!!$R1 2329
4 TraesCS7B01G395700 chr1D 254471216 254473535 2319 True 4000 4000 97.726 1 2330 1 chr1D.!!$R1 2329
5 TraesCS7B01G395700 chr5D 503325309 503327628 2319 True 3995 3995 97.686 1 2330 1 chr5D.!!$R1 2329
6 TraesCS7B01G395700 chr5D 6239165 6241485 2320 False 3984 3984 97.600 1 2330 1 chr5D.!!$F1 2329
7 TraesCS7B01G395700 chr5D 432308255 432310516 2261 False 3783 3783 96.791 1 2272 1 chr5D.!!$F2 2271

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
740 745 7.062371 CGATGTTCTACGAACAAGAATCTCTTT 59.938 37.037 12.74 0.0 33.78 2.52 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2069 2100 1.447314 CCCCGAGTAGTTGCGGTTC 60.447 63.158 0.0 0.0 45.85 3.62 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
740 745 7.062371 CGATGTTCTACGAACAAGAATCTCTTT 59.938 37.037 12.74 0.00 33.78 2.52
1162 1182 6.253298 CGTCTTCAAGAAAAACAGAAATTGCA 59.747 34.615 0.00 0.00 0.00 4.08
1179 1199 7.767198 AGAAATTGCATTTTCATTATGGTCTGG 59.233 33.333 27.09 0.00 37.93 3.86
1296 1317 7.593825 GGATAATATCCTTTTTCGATTGGGTG 58.406 38.462 11.91 0.00 46.19 4.61
1512 1533 4.275689 TGGCGATTGACATGTTGGAATATC 59.724 41.667 0.00 0.00 0.00 1.63
2306 2337 6.114089 AGATACGCTACACCATACTATCGAT 58.886 40.000 2.16 2.16 0.00 3.59
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
168 170 8.623903 TGCAAATACATCAAGGATAGAATCAAC 58.376 33.333 0.00 0.0 0.00 3.18
740 745 8.128322 TGGATTCTCCATTTAATTCGGAAAAA 57.872 30.769 0.00 0.0 42.67 1.94
1044 1062 1.903183 GTGAGTCCTGGTAAAGCTCCT 59.097 52.381 0.00 0.0 0.00 3.69
1162 1182 5.163622 CGTTCTGCCAGACCATAATGAAAAT 60.164 40.000 0.00 0.0 0.00 1.82
1179 1199 8.354011 ACATATCTAAGTAATTGTCGTTCTGC 57.646 34.615 0.00 0.0 0.00 4.26
1296 1317 0.890683 CCAGGAATGGTTGAAGCCAC 59.109 55.000 0.00 0.0 41.94 5.01
1422 1443 6.391227 TTGAACCAGACCTTTTGATCTTTC 57.609 37.500 0.00 0.0 0.00 2.62
2030 2061 7.824779 AGGAATAAGAAAACTCGCTATTCACTT 59.175 33.333 0.00 0.0 0.00 3.16
2069 2100 1.447314 CCCCGAGTAGTTGCGGTTC 60.447 63.158 0.00 0.0 45.85 3.62
2253 2284 8.865090 TGCAAATGGAATTCTAAGGTTTCTTTA 58.135 29.630 5.23 0.0 33.67 1.85
2254 2285 7.734942 TGCAAATGGAATTCTAAGGTTTCTTT 58.265 30.769 5.23 0.0 33.67 2.52
2255 2286 7.301868 TGCAAATGGAATTCTAAGGTTTCTT 57.698 32.000 5.23 0.0 33.67 2.52
2256 2287 6.916360 TGCAAATGGAATTCTAAGGTTTCT 57.084 33.333 5.23 0.0 33.67 2.52
2257 2288 9.305925 CTTATGCAAATGGAATTCTAAGGTTTC 57.694 33.333 5.23 0.0 33.67 2.78
2273 2304 5.364778 TGGTGTAGCGTATCTTATGCAAAT 58.635 37.500 0.00 0.0 43.07 2.32


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.