Multiple sequence alignment - TraesCS7B01G395600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G395600 chr7B 100.000 2333 0 0 1 2333 662738134 662740466 0.000000e+00 4272
1 TraesCS7B01G395600 chr7B 98.020 606 4 4 1730 2333 397633086 397632487 0.000000e+00 1046
2 TraesCS7B01G395600 chr7B 98.813 337 4 0 1383 1719 397633237 397632901 3.320000e-168 601
3 TraesCS7B01G395600 chr7B 99.471 189 1 0 1 189 662736954 662736766 6.170000e-91 344
4 TraesCS7B01G395600 chr2D 99.019 1121 7 1 183 1299 630268595 630269715 0.000000e+00 2006
5 TraesCS7B01G395600 chr2D 98.841 1122 8 2 183 1299 272802292 272801171 0.000000e+00 1995
6 TraesCS7B01G395600 chr2D 97.872 611 2 7 1730 2333 630265023 630264417 0.000000e+00 1046
7 TraesCS7B01G395600 chr2D 97.545 611 4 7 1730 2333 33931836 33932442 0.000000e+00 1035
8 TraesCS7B01G395600 chr2D 99.701 334 1 0 1386 1719 630265171 630264838 1.530000e-171 612
9 TraesCS7B01G395600 chr2D 97.354 189 5 0 1 189 196964310 196964498 2.890000e-84 322
10 TraesCS7B01G395600 chr2D 97.382 191 1 1 3 189 630268660 630268470 2.890000e-84 322
11 TraesCS7B01G395600 chr2D 96.891 193 2 1 1 189 272802225 272802417 1.040000e-83 320
12 TraesCS7B01G395600 chr2D 98.343 181 3 0 1 181 141103074 141103254 3.740000e-83 318
13 TraesCS7B01G395600 chr1B 98.836 1117 13 0 183 1299 633729493 633728377 0.000000e+00 1991
14 TraesCS7B01G395600 chr1B 98.413 189 3 0 1 189 633729430 633729618 1.340000e-87 333
15 TraesCS7B01G395600 chr3B 98.834 1115 13 0 183 1297 201561403 201560289 0.000000e+00 1988
16 TraesCS7B01G395600 chr3B 98.678 605 4 2 1730 2333 201490880 201490279 0.000000e+00 1070
17 TraesCS7B01G395600 chr3B 98.815 422 4 1 1299 1719 201491115 201490694 0.000000e+00 750
18 TraesCS7B01G395600 chr3B 99.471 189 1 0 1 189 201561340 201561528 6.170000e-91 344
19 TraesCS7B01G395600 chr3B 97.895 95 0 2 1299 1392 237300147 237300240 1.850000e-36 163
20 TraesCS7B01G395600 chr3A 98.297 1116 18 1 183 1298 672879060 672877946 0.000000e+00 1954
21 TraesCS7B01G395600 chr3A 98.413 189 3 0 1 189 672878997 672879185 1.340000e-87 333
22 TraesCS7B01G395600 chr5B 97.851 1117 24 0 183 1299 432876095 432877211 0.000000e+00 1930
23 TraesCS7B01G395600 chr5D 97.048 1118 29 3 184 1299 432293347 432292232 0.000000e+00 1879
24 TraesCS7B01G395600 chr5D 96.865 606 13 3 1730 2333 6238149 6238750 0.000000e+00 1009
25 TraesCS7B01G395600 chr5D 99.701 334 1 0 1386 1719 6238001 6238334 1.530000e-171 612
26 TraesCS7B01G395600 chr5D 98.521 338 1 1 1386 1719 503328810 503328473 5.550000e-166 593
27 TraesCS7B01G395600 chr5D 97.802 91 1 1 1299 1388 432306198 432306288 3.100000e-34 156
28 TraesCS7B01G395600 chr5D 97.802 91 1 1 1299 1388 503329023 503328933 3.100000e-34 156
29 TraesCS7B01G395600 chr4A 96.872 1119 31 3 183 1299 310761777 310762893 0.000000e+00 1869
30 TraesCS7B01G395600 chr4A 96.068 1119 38 5 183 1299 219340497 219339383 0.000000e+00 1818
31 TraesCS7B01G395600 chr4A 98.512 605 4 2 1730 2333 141127802 141127202 0.000000e+00 1062
32 TraesCS7B01G395600 chr1A 98.512 605 4 2 1730 2333 554450067 554450667 0.000000e+00 1062
33 TraesCS7B01G395600 chr1A 99.287 421 2 1 1299 1719 554449833 554450252 0.000000e+00 760
34 TraesCS7B01G395600 chr3D 97.709 611 2 7 1730 2333 24163807 24163202 0.000000e+00 1040
35 TraesCS7B01G395600 chrUn 98.000 600 2 6 1730 2323 406224664 406225259 0.000000e+00 1033
36 TraesCS7B01G395600 chrUn 99.287 421 2 1 1299 1719 429254166 429254585 0.000000e+00 760
37 TraesCS7B01G395600 chrUn 100.000 334 0 0 1386 1719 432962594 432962927 3.290000e-173 617
38 TraesCS7B01G395600 chrUn 99.403 335 1 1 1386 1719 406224515 406224849 7.130000e-170 606
39 TraesCS7B01G395600 chrUn 97.802 91 1 1 1299 1388 406224308 406224398 3.100000e-34 156
40 TraesCS7B01G395600 chrUn 97.802 91 1 1 1299 1388 432962387 432962477 3.100000e-34 156
41 TraesCS7B01G395600 chr1D 96.364 605 20 2 1730 2333 244766242 244765639 0.000000e+00 994
42 TraesCS7B01G395600 chr1D 97.802 91 1 1 1299 1388 254475111 254475021 3.100000e-34 156
43 TraesCS7B01G395600 chr6B 98.942 189 2 0 1 189 450081525 450081713 2.870000e-89 339


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G395600 chr7B 662738134 662740466 2332 False 4272.000000 4272 100.000000 1 2333 1 chr7B.!!$F1 2332
1 TraesCS7B01G395600 chr7B 397632487 397633237 750 True 823.500000 1046 98.416500 1383 2333 2 chr7B.!!$R2 950
2 TraesCS7B01G395600 chr2D 630268595 630269715 1120 False 2006.000000 2006 99.019000 183 1299 1 chr2D.!!$F5 1116
3 TraesCS7B01G395600 chr2D 272801171 272802292 1121 True 1995.000000 1995 98.841000 183 1299 1 chr2D.!!$R1 1116
4 TraesCS7B01G395600 chr2D 33931836 33932442 606 False 1035.000000 1035 97.545000 1730 2333 1 chr2D.!!$F1 603
5 TraesCS7B01G395600 chr2D 630264417 630268660 4243 True 660.000000 1046 98.318333 3 2333 3 chr2D.!!$R2 2330
6 TraesCS7B01G395600 chr1B 633728377 633729493 1116 True 1991.000000 1991 98.836000 183 1299 1 chr1B.!!$R1 1116
7 TraesCS7B01G395600 chr3B 201560289 201561403 1114 True 1988.000000 1988 98.834000 183 1297 1 chr3B.!!$R1 1114
8 TraesCS7B01G395600 chr3B 201490279 201491115 836 True 910.000000 1070 98.746500 1299 2333 2 chr3B.!!$R2 1034
9 TraesCS7B01G395600 chr3A 672877946 672879060 1114 True 1954.000000 1954 98.297000 183 1298 1 chr3A.!!$R1 1115
10 TraesCS7B01G395600 chr5B 432876095 432877211 1116 False 1930.000000 1930 97.851000 183 1299 1 chr5B.!!$F1 1116
11 TraesCS7B01G395600 chr5D 432292232 432293347 1115 True 1879.000000 1879 97.048000 184 1299 1 chr5D.!!$R1 1115
12 TraesCS7B01G395600 chr5D 6238001 6238750 749 False 810.500000 1009 98.283000 1386 2333 2 chr5D.!!$F2 947
13 TraesCS7B01G395600 chr5D 503328473 503329023 550 True 374.500000 593 98.161500 1299 1719 2 chr5D.!!$R2 420
14 TraesCS7B01G395600 chr4A 310761777 310762893 1116 False 1869.000000 1869 96.872000 183 1299 1 chr4A.!!$F1 1116
15 TraesCS7B01G395600 chr4A 219339383 219340497 1114 True 1818.000000 1818 96.068000 183 1299 1 chr4A.!!$R2 1116
16 TraesCS7B01G395600 chr4A 141127202 141127802 600 True 1062.000000 1062 98.512000 1730 2333 1 chr4A.!!$R1 603
17 TraesCS7B01G395600 chr1A 554449833 554450667 834 False 911.000000 1062 98.899500 1299 2333 2 chr1A.!!$F1 1034
18 TraesCS7B01G395600 chr3D 24163202 24163807 605 True 1040.000000 1040 97.709000 1730 2333 1 chr3D.!!$R1 603
19 TraesCS7B01G395600 chrUn 406224308 406225259 951 False 598.333333 1033 98.401667 1299 2323 3 chrUn.!!$F2 1024
20 TraesCS7B01G395600 chrUn 432962387 432962927 540 False 386.500000 617 98.901000 1299 1719 2 chrUn.!!$F3 420
21 TraesCS7B01G395600 chr1D 244765639 244766242 603 True 994.000000 994 96.364000 1730 2333 1 chr1D.!!$R1 603

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
818 2964 4.141914 ACTTTACCGAGGATGAGAATGGAC 60.142 45.833 0.0 0.0 0.0 4.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1647 4120 1.774856 ACAATGCATAGGACTACCCCC 59.225 52.381 0.0 0.0 36.73 5.4 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
818 2964 4.141914 ACTTTACCGAGGATGAGAATGGAC 60.142 45.833 0.00 0.00 0.00 4.02
1164 3465 6.811253 AAATCAATTACACCAGAGCGTTTA 57.189 33.333 0.00 0.00 0.00 2.01
1666 4139 2.568623 GGGGGTAGTCCTATGCATTG 57.431 55.000 3.54 1.90 35.33 2.82
1667 4140 1.774856 GGGGGTAGTCCTATGCATTGT 59.225 52.381 3.54 0.00 35.33 2.71
1668 4141 2.487265 GGGGGTAGTCCTATGCATTGTG 60.487 54.545 3.54 0.00 35.33 3.33
1669 4142 2.222027 GGGTAGTCCTATGCATTGTGC 58.778 52.381 3.54 0.00 45.29 4.57
1670 4143 5.578615 GGGGTAGTCCTATGCATTGTGCA 62.579 52.174 3.54 7.12 46.44 4.57
1684 4157 6.966435 GCATTGTGCATGGTTTACTTAAAT 57.034 33.333 0.00 0.00 44.26 1.40
1686 4159 8.472683 GCATTGTGCATGGTTTACTTAAATAA 57.527 30.769 0.00 0.00 44.26 1.40
1687 4160 8.930760 GCATTGTGCATGGTTTACTTAAATAAA 58.069 29.630 0.00 0.00 44.26 1.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
818 2964 7.938140 TTTCCATCCAAGATTTAGTAACTGG 57.062 36.000 0.0 0.0 0.00 4.00
1164 3465 0.673644 CAAAGTGGATTCGCCCTCGT 60.674 55.000 0.0 0.0 36.96 4.18
1647 4120 1.774856 ACAATGCATAGGACTACCCCC 59.225 52.381 0.0 0.0 36.73 5.40
1648 4121 2.851195 CACAATGCATAGGACTACCCC 58.149 52.381 0.0 0.0 36.73 4.95
1649 4122 2.222027 GCACAATGCATAGGACTACCC 58.778 52.381 0.0 0.0 44.26 3.69
1661 4134 6.966435 ATTTAAGTAAACCATGCACAATGC 57.034 33.333 0.0 0.0 45.29 3.56
2098 4588 4.903149 TCAAGTCCCTCTATCCCCAAATA 58.097 43.478 0.0 0.0 0.00 1.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.